Login to display prices
Login to display prices
MMD-monocyte to macrophage differentiation-associated Gene View larger

MMD-monocyte to macrophage differentiation-associated Gene

PTXBC026324

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MMD-monocyte to macrophage differentiation-associated Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MMD-monocyte to macrophage differentiation-associated Gene

Proteogenix catalog: PTXBC026324
Ncbi symbol: MMD
Product name: MMD-monocyte to macrophage differentiation-associated Gene
Size: 2ug
Accessions: BC026324
Gene id: 23531
Gene description: monocyte to macrophage differentiation-associated
Synonyms: MMA; MMD1; PAQR11; monocyte to macrophage differentiation factor; macrophage maturation-associated; monocyte to macrophage differentiation protein; progestin and adipoQ receptor family member 11; progestin and adipoQ receptor family member XI; monocyte to macrophage differentiation associated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggttcaagaatcgattccagcggttcatgaaccatcgagctccagccaatggccgctacaagccaacttgctatgaacatgctgctaactgttacacacacgcattcctcattgttccggccatcgtgggcagtgccctcctccatcggctgtctgatgactgctgggaaaagataacagcatggatttatggaatgggactctgtgccctcttcatcgtttctacagtatttcacattgtatcatggaaaaagagccacttaaggacagtggagcattgttttcacatgtgtgatagaatggttatctatttcttcattgctgcttcttatgctccatggttaaatcttcgtgaacttggacccctggcatctcatatgcgttggtttatctggctcatggcagctggaggaaccatttatgtatttctctaccatgaaaaatataaggtggttgaactctttttctatctcacaatgggattctctccagccttggtggtgacatcaatgaacaacaccgatggacttcaggaacttgcctgtgggggcttaatttattgcttgggagttgtgttcttcaagagtgatggcatcattccatttgcccacgccatctggcacctgtttgtggccacggcagctgcagtgcattactacgccatttggaaatacctttaccgaagtcctacggactttatgcggcatttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: