LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene View larger

LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene

PTXBC005399

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005399
Product type: DNA & cDNA
Ncbi symbol: LRRIQ1
Origin species: Human
Product name: LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene
Size: 2ug
Accessions: BC005399
Gene id: 84125
Gene description: leucine-rich repeats and IQ motif containing 1
Synonyms: leucine-rich repeat and IQ domain-containing protein 1; testicular tissue protein Li 111; leucine rich repeats and IQ motif containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgatgatgatgcaaagctcaaagcagaaatagaagctgaattggataaactcagcatttcctccttggaaaaagaagacattgagagtgatgcaaaatcagaaacccagagtgatgatagtgatacagattcagttgaattaccagaatcagttcttcactgtattaacatcataaagaacaggagtaaagctgttgaagagctcattcttcaggacctggaagatattttaagctgtagttatggagcagtttctaataatcatatgcatttaagaacaggactatcaactgaatatgaagaaagttcagagcaattaattaagatattatctgaaatagaaaaagaagaatttatgagaagtaaaaccgattgtgccactcctgattttgttcctgagcctagtcctcatgacttgcctatggatgaacatgttttaccagatgatgctgatataaattttggatactgtgaagtggaagaaaaatgtagacagtcttttgaggcttggcaagagaaacagaaggaattagaagataaagagaaacaaactctcaaagctcagagggatagagaagaaaaacaatttcaagaagaagaagaaaagcgacattgctggatgaaacaatttaaagttgaaaagaagaaattagagaacattcagaaggtattttgcttttgtttttcatgtatttttaaaatcagtagctacctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aminocarboxymuconate semialdehyde decarboxylase
- transcription elongation factor A (SII)-like 8
- interferon, alpha-inducible protein 27-like 2
- family with sequence similarity 134, member B

Buy LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene now

Add to cart