Login to display prices
Login to display prices
LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene View larger

LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene

Proteogenix catalog: PTXBC005399
Ncbi symbol: LRRIQ1
Product name: LRRIQ1-leucine-rich repeats and IQ motif containing 1 Gene
Size: 2ug
Accessions: BC005399
Gene id: 84125
Gene description: leucine-rich repeats and IQ motif containing 1
Synonyms: leucine-rich repeat and IQ domain-containing protein 1; testicular tissue protein Li 111; leucine rich repeats and IQ motif containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgatgatgatgcaaagctcaaagcagaaatagaagctgaattggataaactcagcatttcctccttggaaaaagaagacattgagagtgatgcaaaatcagaaacccagagtgatgatagtgatacagattcagttgaattaccagaatcagttcttcactgtattaacatcataaagaacaggagtaaagctgttgaagagctcattcttcaggacctggaagatattttaagctgtagttatggagcagtttctaataatcatatgcatttaagaacaggactatcaactgaatatgaagaaagttcagagcaattaattaagatattatctgaaatagaaaaagaagaatttatgagaagtaaaaccgattgtgccactcctgattttgttcctgagcctagtcctcatgacttgcctatggatgaacatgttttaccagatgatgctgatataaattttggatactgtgaagtggaagaaaaatgtagacagtcttttgaggcttggcaagagaaacagaaggaattagaagataaagagaaacaaactctcaaagctcagagggatagagaagaaaaacaatttcaagaagaagaagaaaagcgacattgctggatgaaacaatttaaagttgaaaagaagaaattagagaacattcagaaggtattttgcttttgtttttcatgtatttttaaaatcagtagctacctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: