FAM134B-family with sequence similarity 134, member B Gene View larger

FAM134B-family with sequence similarity 134, member B Gene

PTXBC030517

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM134B-family with sequence similarity 134, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM134B-family with sequence similarity 134, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030517
Product type: DNA & cDNA
Ncbi symbol: FAM134B
Origin species: Human
Product name: FAM134B-family with sequence similarity 134, member B Gene
Size: 2ug
Accessions: BC030517
Gene id: 54463
Gene description: family with sequence similarity 134, member B
Synonyms: protein FAM134B; reticulophagy receptor FAM134B; JK-1; JK1; family with sequence similarity 134 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaacaaatgatgaagatgaattaagccttggtttgcccactgagctcaagagaaagaaggaacagttggacagtggtcacagaccaagcaaagagacgcaatcagcagctggtctcacccttcctctgaacagtgaccaaacctttcacctgatgagcaacctggctggggatgttatcacagctgcagtgactgcagctatcaaagaccagttagagggtgtgcagcaagcactttctcaggctgcccccatcccagaagaggacacagacactgaagaaggtgatgactttgaactacttgaccagtcagagctggatcaaattgagagtgaattgggacttacacaagaccaggaagcagaagcacagcaaaataagaagtcttcaggtttcctttcaaatctgctgggaggccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly (ADP-ribose) polymerase family, member 16
- dehydrogenase/reductase (SDR family) member 13
- purinergic receptor P2Y, G-protein coupled, 14
- ARP3 actin-related protein 3 homolog B (yeast)

Buy FAM134B-family with sequence similarity 134, member B Gene now

Add to cart