PTXBC030517
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM134B |
| Origin species: | Human |
| Product name: | FAM134B-family with sequence similarity 134, member B Gene |
| Size: | 2ug |
| Accessions: | BC030517 |
| Gene id: | 54463 |
| Gene description: | family with sequence similarity 134, member B |
| Synonyms: | protein FAM134B; reticulophagy receptor FAM134B; JK-1; JK1; family with sequence similarity 134 member B |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaacaaatgatgaagatgaattaagccttggtttgcccactgagctcaagagaaagaaggaacagttggacagtggtcacagaccaagcaaagagacgcaatcagcagctggtctcacccttcctctgaacagtgaccaaacctttcacctgatgagcaacctggctggggatgttatcacagctgcagtgactgcagctatcaaagaccagttagagggtgtgcagcaagcactttctcaggctgcccccatcccagaagaggacacagacactgaagaaggtgatgactttgaactacttgaccagtcagagctggatcaaattgagagtgaattgggacttacacaagaccaggaagcagaagcacagcaaaataagaagtcttcaggtttcctttcaaatctgctgggaggccattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - poly (ADP-ribose) polymerase family, member 16 - dehydrogenase/reductase (SDR family) member 13 - purinergic receptor P2Y, G-protein coupled, 14 - ARP3 actin-related protein 3 homolog B (yeast) |