Login to display prices
Login to display prices
PARP16-poly (ADP-ribose) polymerase family, member 16 Gene View larger

PARP16-poly (ADP-ribose) polymerase family, member 16 Gene

PTXBC031074

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARP16-poly (ADP-ribose) polymerase family, member 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PARP16-poly (ADP-ribose) polymerase family, member 16 Gene

Proteogenix catalog: PTXBC031074
Ncbi symbol: PARP16
Product name: PARP16-poly (ADP-ribose) polymerase family, member 16 Gene
Size: 2ug
Accessions: BC031074
Gene id: 54956
Gene description: poly (ADP-ribose) polymerase family, member 16
Synonyms: mono [ADP-ribose] polymerase PARP16; ARTD15; C15orf30; pART15; ADP-ribosyltransferase diphtheria toxin-like 15; PARP-16; poly [ADP-ribose] polymerase 16; poly(ADP-ribose) polymerase family member 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccctcaggctgggcggccgccagggaggcggcgggccgcgacatgctggccgccgacctccggtgcagcctcttcgcctcggccctgcagagctacaagcgcgactcggtgctgcggcccttccccgcgtcctacgcccgcggcgactgtaaggactttgaagccctgcttgcagatgccagcaagttacctaacctgaaagaacttctccagtcctccggagacaaccacaaacgggcctgggacctggtgagctggattttatcctcaaaggtcctgacaatccacagtgcagggaaggcagagtttgaaaagatccaaaagctgactggggctcctcacacgcctgttcctgcaccggacttcctgtttgaaattgagtactttgacccagccaacgccaaattttatgagaccaaaggagaacgagacctaatctatgcatttcatggtagccgcctagaaaacttccattccattatccacaatggcctgcactgccatctgaacaagacatccttgttcggagaggggacctacctcaccagtgacttaagcctggccctcatatacagcccccatggccatgggtggcagcacagcctcctcggccccatccttagctgtgtggccgtgtgtgaggtcattgaccatccggacgtcaagtgccaaaccaagaagaaggattccaaggagatagatcgcagacgagcgagaatcaaacatagtgaagggggagacatccctcccaagtacttcgtggtcaccaataaccagctgctgcgagtgaagtacctcctggtgtattcacagaagccacccaagagggctccgagccagctctcctggttttccagccattggtttaccgtcatgatatccctgtatctgctgctgctgctcatagtgagtgtcatcaactcctctgctttccaacacttttggaatcgtgcgaaaagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: