Login to display prices
Login to display prices
DHRS13-dehydrogenase/reductase (SDR family) member 13 Gene View larger

DHRS13-dehydrogenase/reductase (SDR family) member 13 Gene

PTXBC015582

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHRS13-dehydrogenase/reductase (SDR family) member 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DHRS13-dehydrogenase/reductase (SDR family) member 13 Gene

Proteogenix catalog: PTXBC015582
Ncbi symbol: DHRS13
Product name: DHRS13-dehydrogenase/reductase (SDR family) member 13 Gene
Size: 2ug
Accessions: BC015582
Gene id: 147015
Gene description: dehydrogenase/reductase (SDR family) member 13
Synonyms: SDR7C5; dehydrogenase/reductase SDR family member 13; dehydrogenase/reductase (SDR family) member 13; short chain dehydrogenase/reductase family 7C member 5; dehydrogenase/reductase 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacggcgctggagctggcgcgccggggagcgcgcgtggtgctggcctgccgcagccaggagcgcggggaggcggctgccttcgacctccgccaggagagtgggaacaatgaggtcatcttcatggccttggacttggccagtctggcctcggtgcgggcctttgccactgcctttctgagctctgagccacggttggacatcctcatccacaatgccggtatcagttcctgtggccggacccgtgaggcgtttaacctgctgcttcgggtgaaccatatcggtccctttctgctgacacatctgctgctgccttgcctgaaggcatgtgcccctagccgcgtggtggtggtagcctcagctgcccactgtcggggacgtcttgacttcaaacgcctggaccgcccagtggtgggctggcggcaggagctgcgggcatatgctgacactaagctggctaatgtactgtttgcccgggagctcgccaaccagcttgaggccactggcgtcacctgctatgcagcccacccagggcctgtgaactcggagctgttcctgcgccatgttcctggatggctgcgcccacttttgcgcccattggcttggctggtgctccgggcaccaagagggggtgcccagacacccctgtattgtgctctacaagagggcatcgagcccctcagtgggagatattttgccaactgccatgtggaagaggtgcctccagctgcccgagacgaccgggcagcccatcggctatgggaggccagcaagaggctggcagggcttgggcctggggaggatgctgaacccgatgaagacccccagtctgaggactcagaggccccatcttctctaagcaccccccaccctgaggagcccacagtttctcaaccttaccccagccctcagagctcaccagatttgtctaagatgacgcaccgaattcaggctaaagttgagcctgagatccagctctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: