CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene View larger

CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038354
Product type: DNA & cDNA
Ncbi symbol: CHI3L1
Origin species: Human
Product name: CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene
Size: 2ug
Accessions: BC038354
Gene id: 1116
Gene description: chitinase 3-like 1 (cartilage glycoprotein-39)
Synonyms: ASRT7; CGP-39; GP-39; GP39; HC-gp39; HCGP-3P; YKL-40; YKL40; YYL-40; hCGP-39; chitinase-3-like protein 1; 39 kDa synovial protein; cartilage glycoprotein 39; chitinase 3-like 1 (cartilage glycoprotein-39); chitinase 3 like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgtgaaggcgtctcaaacaggctttgtggtcctggtgctgctccagtgctgctctgcatacaaactggtctgctactacaccagctggtcccagtaccgggaaggcgatgggagctgcttcccagatgcccttgaccgcttcctctgtacccacatcatctacagctttgccaatataagcaacgatcacatcgacacctgggagtggaatgatgtgacgctctacggcatgctcaacacactcaagaacaggaaccccaacctgaagactctcttgtctgtcggaggatggaactttgggtctcaaagattttccaagatagcctccaacacccagagtcgccggactttcatcaagtcagtaccgccatttctgcgcacccatggctttgatgggctggaccttgcctggctctaccctggacggggagacaaacagcattttaccaccctaatcaaggaaatgaaggccgaatttataaaggaagcccagccagggaaaaagcagctcctgctcagcgcagcactgtctgcggggaaggtcaccattgacagcagctatgacattgccaagatatcccaacacctggatttcattagcatcatgacctacgattttcatggagcctggcgtgggaccacaggccatcacagtcccctgttccgaggtcaggaggatgcaagtcctgacagattcagcaacactgactatgctgtggggtacatgttgaggctgggggctcctgccagtaagctggtgatgggcatccccaccttcgggaggagcttcactctggcttcttctgagactggtgttggagccccaatctcaggaccgggaattccaggccggttcaccaaggaggcagggacccttgcctactatgagatctgtgacttcctccgcggagccacagtccatagaatcctcggccagcaggtcccctatgccaccaagggcaaccagtgggtaggatacgacgaccaggaaagcgtcaaaagcaaggtgcagtacctgaaggacaggcagctggcgggcgccatggtatgggccctggacctggatgacttccagggctccttctgcggccaggatctgcgcttccctctcaccaatgccatcaaggatgcactcgctgcaacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 82, member A1
- family with sequence similarity 172, member A
- adaptor-related protein complex 2, mu 1 subunit
- caspase 2, apoptosis-related cysteine peptidase

Buy CHI3L1-chitinase 3-like 1 (cartilage glycoprotein-39) Gene now

Add to cart