CASP2-caspase 2, apoptosis-related cysteine peptidase Gene View larger

CASP2-caspase 2, apoptosis-related cysteine peptidase Gene

PTXBC002427

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CASP2-caspase 2, apoptosis-related cysteine peptidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CASP2-caspase 2, apoptosis-related cysteine peptidase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002427
Product type: DNA & cDNA
Ncbi symbol: CASP2
Origin species: Human
Product name: CASP2-caspase 2, apoptosis-related cysteine peptidase Gene
Size: 2ug
Accessions: BC002427
Gene id: 835
Gene description: caspase 2, apoptosis-related cysteine peptidase
Synonyms: CASP-2; ICH1; NEDD-2; NEDD2; PPP1R57; caspase 2 apoptosis-related cysteine peptidase; neural precursor cell expressed developmentally down-regulated protein 2; protease ICH-1; protein phosphatase 1, regulatory subunit 57; caspase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgccgagcgcggggtcttggtccaccttccagcacaaggagctgatggccgctgacaggggacgcaggatattgggagtgtgtggcatgcatcctcatcatcaggaaactctaaaaaagaaccgagtggtgctagccaaacagctgttgttgagcgaattattagaacatcttctggagaaggacatcatcaccttggaaatgagggagctcatccaggccaaagtgggcagtttcagccagaatgtggaactcctcaacttgctgcctaagaggggtccccaagcttttgatgccttctgtgaagcactgagggagaccaagcaaggccacctggaggatatgttgctcaccaccctttctgggcttcagcatgtactcccaccgttgagctgtgactacgacttgagtctcccttttccggtgtgtgagtcctgtcccctttacaagaagctccgcctgtcgacagatactgtggaacactccctagacaataaagatggtcctctctgccttcaggtgaagccttgcactcctgaattttatcaaacacacttccagctggcatataggttgcagtctcggcctcgtggcctagcactggtgttgagcaatgtgcacttcactggagagaaagaactggaatttcgctctggaggggatgtggaccacagtactctagtcaccctcttcaagcttttgggctatgacgtccatgttctatgtgaccagactgcacaggaaatgcaagagaaactgcagaattttgcacagttacctgcacaccgagtcacggactcctgcatcgtggcactcctctcgcatggtgtggagggcgccatctatggtgtggatgggaaactgctccagctccaagaggtttttcagctctttgacaacgccaactgcccaagcctacagaacaaaccaaaaatgttcttcatccaggcctgccgtggagatgagactgatcgtggggttgaccaacaagatggaaagaaccacgcaggatcccctgggtgcgaggagagtgatgccggtaaagaaaagttgccgaagatgagactgcccacgcgctcagacatgatatgcggctatgcctgcctcaaagggactgccgccatgcggaacaccaaacgaggttcctggtacatcgaggctcttgctcaagtgttttctgagcgggcttgtgatatgcacgtggccgacatgctggttaaggtgaacgcacttatcaaggatcgggaaggttatgctcctggcacagaattccaccggtgcaaggagatgtctgaatactgcagcactctgtgccgccacctctacctgttcccaggacaccctcccacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDK5 regulatory subunit associated protein 1
- eukaryotic translation initiation factor 2C, 2
- family with sequence similarity 116, member A
- solute carrier family 25, member 13 (citrin)

Buy CASP2-caspase 2, apoptosis-related cysteine peptidase Gene now

Add to cart