CDK5RAP1-CDK5 regulatory subunit associated protein 1 Gene View larger

CDK5RAP1-CDK5 regulatory subunit associated protein 1 Gene


New product

Data sheet of CDK5RAP1-CDK5 regulatory subunit associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDK5RAP1-CDK5 regulatory subunit associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001215
Product type: DNA & cDNA
Ncbi symbol: CDK5RAP1
Origin species: Human
Product name: CDK5RAP1-CDK5 regulatory subunit associated protein 1 Gene
Size: 2ug
Accessions: BC001215
Gene id: 51654
Gene description: CDK5 regulatory subunit associated protein 1
Synonyms: C20orf34; C42; CGI-05; HSPC167; CDK5 regulatory subunit-associated protein 1; CDK5 activator-binding protein C42; CDK5 regulatory subunit associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaccctttacagtgtgtcctccaagtgcagaggtctctggggtggggaccattggcctctgtgtcttggctgtcgctgaggatgtgcagggcacacagcagtctctctagtaccatgtgtcccagtccagagaggcaggaggatggagctcggaaggatttcagctccaggctggctgctggaccgacttttcaacattttttaaaaagtgcctcagctcctcaggagaagctgtcttcagaagtggaagacccacctccctatctcatgatggatgaacttcttggaaggcagagaaaagtctacctcgagacctatggctgccagatgaatgtgaatgacacagagatagcctggtccatcttacagaagagtggctacctgcggaccagtaacctccaagaggcagatgtgattctccttgtcacgtgctctatcagggagaaggctgagcagaccatctggaaccgtttacatcagcttaaagccttgaagacaaggcggccccgctcccgggttcctctgaggattggaattctaggctgcatggctgagaggttgaaggaggagattctcaacagagagaaaatggtagatattttggctggtcctgatgcctaccgggaccttccccagctgctggctgttgctgagtcgggccagcaagctgccaacgtgctgctctctctggacgagacctatgctgatgtcatgccagtccagacaagcgccagtgccacgtctgcctttgtgtcaatcatgcgaggctgtgacaacatgtgtagctactgcattgttcctttcacccggggcagggagaggagtcggcctattgcctccattctagaggaagtgaagaagctttctgagcaggttctgcagctgattcatgagagagataacatctgtaaacagatccacctgccagcccagagtggaagcagccgtgtgttggaggccatgcggaggggatattcaagagaagcttatgtggagttagttcaccatattagagaatctattccaggtgtgagcctcagcagcgatttcattgctggcttttgtggtgagacggaggaagatcacgtccagacagtctctttgctccgggaagttcagtacaacatgggcttcctctttgcctacagcatgagacagaagacacgggcatatcataggctgaaggatgatgtcccggaagaggtaaaattaaggcgtttggaggaactcatcactatcttccgagaagaagcaacaaaagccaatcagacctctgtgggctgtacccagttggtgctagtggaagggctcagtaaacgctctgccactgacctgtgtggcaggaatgatggaaaccttaaggtgatcttccctgatgcagagatggaggatgtcaataaccctgggctcagggtcagagcccagcctggggactatgtgctggtgaagatcacctcagccagttctcagacacttaggggacatgttctctgcaggaccactctgagggactcttctgcatattgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2C, 2
- family with sequence similarity 116, member A
- solute carrier family 25, member 13 (citrin)
- acyl-CoA synthetase short-chain family member 1