Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of P2RY14-purinergic receptor P2Y, G-protein coupled, 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P2RY14-purinergic receptor P2Y, G-protein coupled, 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034989 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P2RY14 |
| Origin species: | Human |
| Product name: | P2RY14-purinergic receptor P2Y, G-protein coupled, 14 Gene |
| Size: | 2ug |
| Accessions: | BC034989 |
| Gene id: | 9934 |
| Gene description: | purinergic receptor P2Y, G-protein coupled, 14 |
| Synonyms: | BPR105; GPR105; P2Y14; P2Y purinoceptor 14; G protein coupled receptor for UDP-glucose; G-protein coupled receptor 105; P2Y(14) receptor; P2Y14 receptor; UDP-glucose receptor; purinergic receptor P2Y, G-protein coupled, 14; purinergic receptor P2Y14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcaattcaacctccacacagcctccagatgaatcctgctctcagaacctcctgatcactcagcagatcattcctgtgctgtactgtatggtcttcattgcaggaatcctactcaatggagtgtcaggatggatattcttttacgtgcccagctctgagagtttcatcatctatctcaagaacattgttattgctgactttgtgatgagcctgacttttcctttcaagatccttggtgactcaggccttggtccctggcagctgaacgtgtttgtgtgcagggtctctgccgtgctcttctacgtcaacatgtacgtcagcattgtgttctttgggctcatcagctttgacagatattataaaattgtaaagcctctttggacttctttcatccagtcagtgagttacagcaaacttctgtcagtgatagtatggatgctcatgctcctccttgctgttccaaatattattctcaccaaccagagtgttagggaggttacacaaataaaatgtatagaactgaaaagtgaactgggacggaagtggcacaaagcatcaaactacatcttcgtggccatcttctggattgtgtttcttttgttaatcgttttctatactgctatcacaaagaaaatctttaagtcccaccttaagtcaagtcggaattccacttcggtcaaaaagaaatctagccgcaacatattcagcatcgtgtttgtgttttttgtctgttttgtaccttaccatattgccagaatcccctacacaaagagtcagaccgaagctcattacagctgccagtcaaaagaaatcttgcggtatatgaaagaattcactctgctactatctgctgcaaatgtatgcttggaccctattatttatttctttctatgccagccgtttagggaaatcttatgtaagaaattgcacattccattaaaagctcagaatgacctagacatttccagaatcaaaagaggaaatacaacacttgaaagcacagatactttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ARP3 actin-related protein 3 homolog B (yeast) - SET domain and mariner transposase fusion gene - chitinase 3-like 1 (cartilage glycoprotein-39) - family with sequence similarity 82, member A1 |