Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ARL2BP-ADP-ribosylation factor-like 2 binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARL2BP-ADP-ribosylation factor-like 2 binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003087 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARL2BP |
| Origin species: | Human |
| Product name: | ARL2BP-ADP-ribosylation factor-like 2 binding protein Gene |
| Size: | 2ug |
| Accessions: | BC003087 |
| Gene id: | 23568 |
| Gene description: | ADP-ribosylation factor-like 2 binding protein |
| Synonyms: | BART; BART1; RP66; ADP-ribosylation factor-like protein 2-binding protein; ADP-ribosylation factor like 2 binding protein; ARF-like 2-binding protein; ARL2-binding protein; Arf-like 2 binding protein BART1; binder of ARF2 protein 1; binder of Arl Two; binder of Arl2; retinitis pigmentosa 66 (autosomal recessive); ADP ribosylation factor like GTPase 2 binding protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgccttagaaggagagagctttgcgctgtctttctcctccgcctctgatgcagaatttgatgctgtggttggatatttagaggacattatcatggatgacgagttccagttattacagagaaatttcatggacaagtactacctggagtttgaagacacagaagagaataaactcatctacacacctatttttaatgaatacatttctttggtagaaaaatacattgaagaacagctgctgcagcggattcctgagttcaacatggcagccttcaccacaacattacagcaccataaggatgaagtggctggtgacatattcgacatgctgctcaccttcacagattttctggcttttaaagaaatgtttttggactacagagcagaaaaagaaggccgaggactggacttaagcagtggcttagtggtgacttcattgtgcaaatcatcttctctgccagcttcccagaacaatctgcggcactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 158, member A - monocyte to macrophage differentiation-associated - leucine-rich repeats and IQ motif containing 1 - aminocarboxymuconate semialdehyde decarboxylase |