FAM158A-family with sequence similarity 158, member A Gene View larger

FAM158A-family with sequence similarity 158, member A Gene

PTXBC002491

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM158A-family with sequence similarity 158, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM158A-family with sequence similarity 158, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002491
Product type: DNA & cDNA
Ncbi symbol: FAM158A
Origin species: Human
Product name: FAM158A-family with sequence similarity 158, member A Gene
Size: 2ug
Accessions: BC002491
Gene id: 51016
Gene description: family with sequence similarity 158, member A
Synonyms: UPF0172 protein FAM158A; FAM158A; C14orf122; CGI-112; ER membrane protein complex subunit 9; family with sequence similarity 158, member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggaggtggagatctcggccctggcctacgtgaagatgtgcctgcatgctgcccggtacccacacgccgcagtcaacgggctgtttttggcgccagcgccgcggtctggagaatgcctgtgcctcaccgactgtgtgcccctcttccacagccacctggccctgtccgtcatgttggaggtcgccctcaaccaggtggatgtgtggggagcacaggccggtctggtggtggctggttactaccatgccaatgcagctgtgaacgatcagagccctgggcccctggccttgaaaattgctgggcgaattgcagaattcttccctgatgcagtacttattatgttggataatcagaaactggtgcctcagcctcgtgtgcccccggtcatcgtcctggagaaccaaggtctccgctgggtccctaaggataagaacttagtgatgtggagggactgggaagagtcacggcagatggtgggagctctactggaagatcgggcccaccagcaccttgtggactttgactgccaccttgatgacatccggcaggactggaccaaccagcggctcaacactcaaatcacccagtgggttggtcccactaatggaaatggaaatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - monocyte to macrophage differentiation-associated
- leucine-rich repeats and IQ motif containing 1
- aminocarboxymuconate semialdehyde decarboxylase
- transcription elongation factor A (SII)-like 8

Buy FAM158A-family with sequence similarity 158, member A Gene now

Add to cart