USP47-ubiquitin specific peptidase 47 Gene View larger

USP47-ubiquitin specific peptidase 47 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP47-ubiquitin specific peptidase 47 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USP47-ubiquitin specific peptidase 47 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000226
Product type: DNA & cDNA
Ncbi symbol: USP47
Origin species: Human
Product name: USP47-ubiquitin specific peptidase 47 Gene
Size: 2ug
Accessions: BC000226
Gene id: 55031
Gene description: ubiquitin specific peptidase 47
Synonyms: TRFP; ubiquitin carboxyl-terminal hydrolase 47; Trf (TATA binding protein-related factor)-proximal homolog; deubiquitinating enzyme 47; ubiquitin thioesterase 47; ubiquitin thiolesterase 47; ubiquitin-specific-processing protease 47; ubiquitin specific peptidase 47
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtccatgtcacagcttgcagttttgtcaagacggtggaagccttcagagatgaagttggatcccttccaggaggttgtattggaaagcagtagtgtggacgaattgcgagagaagcttagtgaaatcagtgggattcctttggatgatattgaatttgctaagggtagaggaacatttccctgtgatatttctgtccttgatattcatcaagatttagactggaatcctaaagtttctaccctgaatgtctggcctctttatatctgtgatgatggtgcggtcatattttatagggataaaacagaagaattaatggaattgacagatgagcaaagaaatgaactgatgaaaaaagaaagcagtcgactccagaagactggacatcgtgtaacatactcacctcgtaaagagaaagcactaaaaatatatctggatggagcaccaaataaagatctgactcaagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synovial sarcoma, X breakpoint 2
- ADP-ribosylation factor-like 4A
- ADP-ribosylation factor-like 4D
- chromatin modifying protein 2A

Buy USP47-ubiquitin specific peptidase 47 Gene now

Add to cart