COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene View larger

COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene

PTXBC010739

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010739
Product type: DNA & cDNA
Ncbi symbol: COPS7B
Origin species: Human
Product name: COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene
Size: 2ug
Accessions: BC010739
Gene id: 64708
Gene description: COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)
Synonyms: CSN7B; SGN7b; COP9 signalosome complex subunit 7b; COP9 constitutive photomorphogenic homolog subunit 7B; JAB1-containing signalosome subunit 7b; signalosome subunit 7b; COP9 signalosome subunit 7B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgtatcccctactccgtgttgctgaaagacctggagatgcggaatctccgggaactagaagaccttatcattgaggctgtctacactgacatcatccagggcaagctggaccagcgaaaccagctgctggaagtggatttctgcattggccgtgacatccgaaagaaggatatcaataatattgtcaagaccctgcatgaatggtgtgatggctgtgaagcagttctactgggcatcgagcagcaagttctgagagccaaccagtacaaagagaaccacaaccgaactcagcagcaggtagaagcagaggttaccaacatcaagaagacactcaaagccaccgcatcctcctcggctcaggagatggagcagcagctggctgaacgggagtgtccccctcacgctgagcagaggcagcccaccaagaagatgtccaaagtgaaaggtctggtctccagccgccactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
- processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
- potassium voltage-gated channel, subfamily H (eag-related), member 6
- solute carrier family 2 (facilitated glucose transporter), member 9

Buy COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene now

Add to cart