KCNH6-potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene View larger

KCNH6-potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene


New product

Data sheet of KCNH6-potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNH6-potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006334
Product type: DNA & cDNA
Ncbi symbol: KCNH6
Origin species: Human
Product name: KCNH6-potassium voltage-gated channel, subfamily H (eag-related), member 6 Gene
Size: 2ug
Accessions: BC006334
Gene id: 81033
Gene description: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: ERG-2; ERG2; HERG2; Kv11.2; hERG-2; potassium voltage-gated channel subfamily H member 6; eag-related gene member 2; ether-a-go-go-related protein 2; potassium channel, voltage gated eag related subfamily H, member 6; potassium voltage-gated channel, subfamily H (eag-related), member 6; voltage-gated potassium channel subunit Kv11.2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggtccgcaggggccacgtcgctccccaaaacacttacctggacaccatcatccgcaagttcgagggccaaagtcggaagttcctgattgccaatgctcagatggagaactgcgccatcatttactgcaacgacggcttctgcgaactcttcggctactcccgagtggaggtgatgcagcaaccctgcacctgcgacttcctcacaggccccaacacaccaagcagcgccgtgtcccgcctagcgcaggccctgctgggggctgaggagtgcaaggtggacatcctctactaccgcaaggatgcctccagcttccgctgcctggtagatgtggtgcccgtgaagaacgaggacggggctgtcatcatgttcattctcaacttcgaggacctggcccagctcctggccaagtgcagcagccgcagcttgtcccagcgcctgttgtcccagagcttcctgggctccgagggctctcatggcaggccaggcggaccagggccaggcacaggcaggggcaagtacaggaccatcagccagatcccacagttcacgctcaacttcgtggagttcaacttggagaagcaccgctccagctccaccacggagattgagatcatcgcgccccataaggtggtggagcggacacagaacgtcactgagaaggtcacccaggtcctgtccctgggcgcggatgtgctgccggagtacaagctgcaggcgccgcgcatccaccgctggaccatcctgcactacagccccttcaaggccgtgtgggactggctcatcctgctgctggtcatctacacggctgtcttcacgccctactcagccgccttcctgctcagcgaccaggacgaatcacggcgtggggcctgcagctatacctgcagtcccctcactgtggtggatctcatcgtggacatcatgttcgtcgtggacatcgtcatcaacttccgcaccacctatgtcaacaccaatgatgaggtggtcagccacccccgccgcatcgccgtccactacttcaagggctggttcctcattgacatggtggccgccatccctttcgacctcctgatcttccgcactggctccgatgagaccacaaccctgattgggctattgaagacagcgcggctgctgcggctggtgcgcgtagcacggaagctggaccgctactctgagtatggggcggctgtgctcttcttgctcatgtgcaccttcgcgctcatagcgcactggctggcctgcatctggtacgccatcggcaatgtggagcggccctacctagaacacaagatcggctggctggacagcctgggtgtgcagcttggcaagcgctacaacggcagcgacccagcctcgggcccctcggtgcaggacaagtatgtcacagccctctacttcaccttcagcagcctcaccagcgtgggcttcggcaatgtctcgcccaacaccaactccgagaaggtcttctccatctgcgtcatgctcatcggctgtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 2 (facilitated glucose transporter), member 9
- solute carrier family 4, sodium bicarbonate cotransporter, member 8
- chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)
- inhibitor of DNA binding 2, dominant negative helix-loop-helix protein