SLC2A9-solute carrier family 2 (facilitated glucose transporter), member 9 Gene View larger

SLC2A9-solute carrier family 2 (facilitated glucose transporter), member 9 Gene


New product

Data sheet of SLC2A9-solute carrier family 2 (facilitated glucose transporter), member 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC2A9-solute carrier family 2 (facilitated glucose transporter), member 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018897
Product type: DNA & cDNA
Ncbi symbol: SLC2A9
Origin species: Human
Product name: SLC2A9-solute carrier family 2 (facilitated glucose transporter), member 9 Gene
Size: 2ug
Accessions: BC018897
Gene id: 56606
Gene description: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: GLUT9; GLUTX; UAQTL2; URATv1; solute carrier family 2, facilitated glucose transporter member 9; GLUT-9; glucose transporter type 9; human glucose transporter-like protein-9; solute carrier family 2 (facilitated glucose transporter), member 9; urate voltage-driven efflux transporter 1; solute carrier family 2 member 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctcagtaaaaaggaccgaggagaagatgaagaaagtgattcagcgaaaaagaaattggactggtcctgctcgctcctcgtggcctccctcgcgggcgccttcggctcctccttcctctacggctacaacctgtcggtggtgaatgcccccaccccgtacatcaaggccttttacaatgagtcatgggaaagaaggcatggacgtccaatagacccagacactctgactctgctctggtctgtgactgtgtccatattcgccatcggtggacttgtggggacattaattgtgaagatgattggaaaggttcttgggaggaagcacactttgctggccaataatgggtttgcaatttctgctgcattgctgatggcctgctcgctccaggcaggagcctttgaaatgctcatcgtgggacgcttcatcatgggcatagatggaggcgtcgccctcagtgtgctccccatgtacctcagtgagatctcacccaaggagatccgtggctctctggggcaggtgactgccatctttatctgcattggcgtgttcactgggcagcttctgggcctgcccgagctgctgggaaaggagagtacctggccatacctgtttggagtgattgtggtccctgccgttgtccagctgctgagccttccctttctcccggacagcccacgctacctgctcttggagaagcacaacgaggcaagagctgtgaaagccttccaaacgttcttgggtaaagcagacgtttcccaagaggtagaggaggtcctggctgagagccgcgtgcagaggagcatccgcctggtgtccgtgctggagctgctgagagctccctacgtccgctggcaggtggtcaccgtgattgtcaccatggcctgctaccagctctgtggcctcaatgcaatttggttctataccaacagcatctttggaaaagctgggatccctctggcaaagatcccatacgtcaccttgagtacagggggcatcgagactttggctgccgtcttctctggtttggtcattgagcacctgggacggagacccctcctcattggtggctttgggctcatgggcctcttctttgggaccctcaccatcacgctgaccctgcaggaccacgccccctgggtcccctacctgagtatcgtgggcattctggccatcatcgcctctttctgcagtgggccaggtggcatcccgttcatcttgactggtgagttcttccagcaatctcagcggccggctgccttcatcattgcaggcaccgtcaactggctctccaactttgctgttgggctcctcttcccattcattcagaaaagtctggacacctactgtttcctagtctttgctacaatttgtatcacaggtgctatctacctgtattttgtgctgcctgagaccaaaaacagaacctatgcagaaatcagccaggcattttccaaaaggaacaaagcatacccaccagaagagaaaatcgactcagctgtcactgatggtaagataaatggaaggccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 4, sodium bicarbonate cotransporter, member 8
- chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)
- inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
- succinate dehydrogenase complex, subunit D, integral membrane protein