POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012505
Product type: DNA & cDNA
Ncbi symbol: POP5
Origin species: Human
Product name: POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012505
Gene id: 51367
Gene description: processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP5 homolog, ribonuclease P/MRP subunit; ribonuclease P/MRP protein subunit POP5; HSPC004; RPP2; RPP20; hPop5; processing of precursor 5, ribonuclease P/MRP subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggttcaagcacaggtacctgctctgcgaactggtgtctgacgacccccgctgccgcctaagcctcgatgaccgagttctgagcagcctcgtacgggacacgatcgccagggtgcacggaactttcggcgcagccgcctgctccatcggcttcgcggttcgatatctcaatgcctatactggaatagtgctacttcgatgcagaaaagaattctatcagcttgtgtggtcagctcttcccttcatcacatacttggagaacaaaggacaccgttacccatgctttttcaacacattacatgtgggaggtacaataagaacatgtcagaagttcctaattcagtacaacaggagacagctgttgatcttgttgcagaactgcactgatgaaggagagcgggaagctatccagaagtctgtgacaagaagctgcttactagaggaggaggaggagtcaggtgaggaggctgcagaagcaatggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
- potassium voltage-gated channel, subfamily H (eag-related), member 6
- solute carrier family 2 (facilitated glucose transporter), member 9
- solute carrier family 4, sodium bicarbonate cotransporter, member 8

Buy POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene now

Add to cart