Login to display prices
Login to display prices
POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene

PTXBC012505

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Proteogenix catalog: PTXBC012505
Ncbi symbol: POP5
Product name: POP5-processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012505
Gene id: 51367
Gene description: processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP5 homolog, ribonuclease P/MRP subunit; ribonuclease P/MRP protein subunit POP5; HSPC004; RPP2; RPP20; hPop5; processing of precursor 5, ribonuclease P/MRP subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcggttcaagcacaggtacctgctctgcgaactggtgtctgacgacccccgctgccgcctaagcctcgatgaccgagttctgagcagcctcgtacgggacacgatcgccagggtgcacggaactttcggcgcagccgcctgctccatcggcttcgcggttcgatatctcaatgcctatactggaatagtgctacttcgatgcagaaaagaattctatcagcttgtgtggtcagctcttcccttcatcacatacttggagaacaaaggacaccgttacccatgctttttcaacacattacatgtgggaggtacaataagaacatgtcagaagttcctaattcagtacaacaggagacagctgttgatcttgttgcagaactgcactgatgaaggagagcgggaagctatccagaagtctgtgacaagaagctgcttactagaggaggaggaggagtcaggtgaggaggctgcagaagcaatggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: