Login to display prices
Login to display prices
POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Proteogenix catalog: PTXBC006098
Ncbi symbol: POP4
Product name: POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006098
Gene id: 10775
Gene description: processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP4 homolog, ribonuclease P/MRP subunit; RPP29; ribonuclease P protein subunit p29; hPOP4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagtgtgatctaccatgcattgtctcagaaagaggcgaatgactccgatgtccagccttcaggagcacagcgggccgaggccttcgtgagggccttcctgaagcgcagcacgccccgcatgagcccgcaggcccgcgaggaccagctgcagcgcaaggcggtggtcctggagtacttcacccgccacaagcgcaaggagaagaagaagaaagccaaaggcctctctgccaggcaaaggagggagctgcggctctttgacattaaaccagagcagcagagatacagccttttcctccctctccatgaactctggaaacagtacatcagggacctgtgcagtgggctcaagccagacacgcagccacagatgattcaggccaagctcttaaaggcagatcttcacggggctattatttcagtgacaaaatccaaatgcccctcttatgtgggtattacaggaatccttctacaggaaacaaagcacattttcaaaattatcaccaaagaagaccgcctgaaagttatccccaagctaaactgcgtgttcactgtggaaaccgatggctttatttcctacatttacgggagcaaattccagcttcggtcaagtgaacggtctgcgaagaagttcaaagcgaagggaacgattgacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: