POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene View larger

POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

PTXBC006098

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006098
Product type: DNA & cDNA
Ncbi symbol: POP4
Origin species: Human
Product name: POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006098
Gene id: 10775
Gene description: processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae)
Synonyms: POP4 homolog, ribonuclease P/MRP subunit; RPP29; ribonuclease P protein subunit p29; hPOP4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagagtgtgatctaccatgcattgtctcagaaagaggcgaatgactccgatgtccagccttcaggagcacagcgggccgaggccttcgtgagggccttcctgaagcgcagcacgccccgcatgagcccgcaggcccgcgaggaccagctgcagcgcaaggcggtggtcctggagtacttcacccgccacaagcgcaaggagaagaagaagaaagccaaaggcctctctgccaggcaaaggagggagctgcggctctttgacattaaaccagagcagcagagatacagccttttcctccctctccatgaactctggaaacagtacatcagggacctgtgcagtgggctcaagccagacacgcagccacagatgattcaggccaagctcttaaaggcagatcttcacggggctattatttcagtgacaaaatccaaatgcccctcttatgtgggtattacaggaatccttctacaggaaacaaagcacattttcaaaattatcaccaaagaagaccgcctgaaagttatccccaagctaaactgcgtgttcactgtggaaaccgatggctttatttcctacatttacgggagcaaattccagcttcggtcaagtgaacggtctgcgaagaagttcaaagcgaagggaacgattgacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, subfamily H (eag-related), member 6
- solute carrier family 2 (facilitated glucose transporter), member 9
- solute carrier family 4, sodium bicarbonate cotransporter, member 8
- chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)

Buy POP4-processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) Gene now

Add to cart