Login to display prices
Login to display prices
COL20A1-collagen, type XX, alpha 1 Gene View larger

COL20A1-collagen, type XX, alpha 1 Gene

PTXBC019637

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COL20A1-collagen, type XX, alpha 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COL20A1-collagen, type XX, alpha 1 Gene

Proteogenix catalog: PTXBC019637
Ncbi symbol: COL20A1
Product name: COL20A1-collagen, type XX, alpha 1 Gene
Size: 2ug
Accessions: BC019637
Gene id: 57642
Gene description: collagen, type XX, alpha 1
Synonyms: bA261N11.4; collagen alpha-1(XX) chain; collagen, type XX, alpha 1; collagen-like protein; collagen type XX alpha 1 chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaggcctggagggaactgctggcctgcctggaccccctggccccagggggttccagggcatggcaggggccaggggcactagtggagagcgaggacctccagggaccgtggggcccacaggactgccagggcccaaaggggaacgaggagagaagggcgagccgcagtcccttgccaccctctaccagcttgtgagccaggcctgtgagtctgccattcagacacacgtgtcaaagttcgactccttccacgagaacaccaggccccccatgcccatcttggagcagaagctggagccgggcactgagcccctggggtcccctggcacccgcagcaaggccctggttcctggagaatgggggcgtggtggccgccaccttgagggcagaggggagcctggagctgttggtcagatgggcagccctgggcagcagggggctagcacccagggcctctgggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: