YIPF6-Yip1 domain family, member 6 Gene View larger

YIPF6-Yip1 domain family, member 6 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIPF6-Yip1 domain family, member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about YIPF6-Yip1 domain family, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012469
Product type: DNA & cDNA
Ncbi symbol: YIPF6
Origin species: Human
Product name: YIPF6-Yip1 domain family, member 6 Gene
Size: 2ug
Accessions: BC012469
Gene id: 286451
Gene description: Yip1 domain family, member 6
Synonyms: protein YIPF6; FinGER6; YIP1 family member 6; Yip1 domain family member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaagcggaggagtctccaggagacccggggacagcatcgcccaggcccctgtttgcaggcctttcagatatatccatctcacaagacatccccgtagaaggagaaatcaccattcctatgagatctcgcatccgggagtttgacagctccacattaaatgaatctgttcgcaataccatcatgcgtgatctaaaagctgttgggaaaaaattcatgcatgttttgtacccaaggaaaagtaatactcttttgagagattgggatttgtggggccctttgatcctttgtgtgacactcgcattaatgctgcaaagagactctgcagatagtgaaaaagatggagggccccaatttgcagaggtgtttgtcattgtctggtttggtgcagttaccatcaccctcaactcaaaacttcttggagggaacatatctttttttcagagcctctgtgtgctgggttactgtatacttcccttgacagtagcaatgctgatttgccggctggtacttttggctgatccaggacctgtaaacttcatggttcggctttttgtggtgattgtgatgtttgcctggtctatagttgcctccacagctctccttgctgatagccagcctccaaaccgcagagccctagctgtttatcctgttttcctgttttactttgtcatcagttggatgattctcacctttactcctcagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - canopy 4 homolog (zebrafish)
- Yip1 domain family, member 5
- uroporphyrinogen III synthase
- RNA binding motif protein 33

Buy YIPF6-Yip1 domain family, member 6 Gene now

Add to cart