Login to display prices
Login to display prices
YIPF5-Yip1 domain family, member 5 Gene View larger

YIPF5-Yip1 domain family, member 5 Gene

PTXBC007829

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIPF5-Yip1 domain family, member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about YIPF5-Yip1 domain family, member 5 Gene

Proteogenix catalog: PTXBC007829
Ncbi symbol: YIPF5
Product name: YIPF5-Yip1 domain family, member 5 Gene
Size: 2ug
Accessions: BC007829
Gene id: 81555
Gene description: Yip1 domain family, member 5
Synonyms: protein YIPF5; FinGER5; SB140; SMAP-5; SMAP5; YIP1A; YIP1 family member 5; YPT-interacting protein 1 A; five-pass transmembrane protein localizing in the Golgi apparatus and the endoplasmic reticulum 5; golgi membrane protein SB140; smooth muscle cell associated protein 5; Yip1 domain family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggctttgaaaacttaaacacggatttctaccagacaagttacagcatcgatgatcagtcacagcagtcctatgattatggaggaagtggaggaccctatagcaaacagtatgctggctatgactattcgcagcaaggcagatttgtccctccagacatgatgcagccacaacagccatacaccgggcagatttaccagccaactcaggcatatactccagcttcacctcagcctttctatggaaacaactttgaggatgagccacctttattagaagagttaggtatcaattttgaccacatctggcaaaaaacactaacagtattacatccgttaaaagtagcagatggcagcatcatgaatgaaactgatttggcaggtccaatggttttttgccttgcttttggagccacattgctactggctggcaaaatccagtttggctatgtatacgggatcagtgcaattggatgtctaggaatgttttgtttattaaacttaatgagtatgacaggtgtttcatttggttgtgtggcaagtgtccttggatattgtcttctgcccatgatcctactttccagctttgcagtgatattttctttgcaaggaatggtaggaatcattctcactgctgggattattggatggtgtagtttttctgcttccaaaatatttatttctgcattagccatggaaggacagcaacttttagtagcatatccttgcgctttgttatatggagtctttgccctgatttccgtcttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: