Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of YIPF5-Yip1 domain family, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YIPF5-Yip1 domain family, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007829 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YIPF5 |
| Origin species: | Human |
| Product name: | YIPF5-Yip1 domain family, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC007829 |
| Gene id: | 81555 |
| Gene description: | Yip1 domain family, member 5 |
| Synonyms: | protein YIPF5; FinGER5; SB140; SMAP-5; SMAP5; YIP1A; YIP1 family member 5; YPT-interacting protein 1 A; five-pass transmembrane protein localizing in the Golgi apparatus and the endoplasmic reticulum 5; golgi membrane protein SB140; smooth muscle cell associated protein 5; Yip1 domain family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaggctttgaaaacttaaacacggatttctaccagacaagttacagcatcgatgatcagtcacagcagtcctatgattatggaggaagtggaggaccctatagcaaacagtatgctggctatgactattcgcagcaaggcagatttgtccctccagacatgatgcagccacaacagccatacaccgggcagatttaccagccaactcaggcatatactccagcttcacctcagcctttctatggaaacaactttgaggatgagccacctttattagaagagttaggtatcaattttgaccacatctggcaaaaaacactaacagtattacatccgttaaaagtagcagatggcagcatcatgaatgaaactgatttggcaggtccaatggttttttgccttgcttttggagccacattgctactggctggcaaaatccagtttggctatgtatacgggatcagtgcaattggatgtctaggaatgttttgtttattaaacttaatgagtatgacaggtgtttcatttggttgtgtggcaagtgtccttggatattgtcttctgcccatgatcctactttccagctttgcagtgatattttctttgcaaggaatggtaggaatcattctcactgctgggattattggatggtgtagtttttctgcttccaaaatatttatttctgcattagccatggaaggacagcaacttttagtagcatatccttgcgctttgttatatggagtctttgccctgatttccgtcttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - uroporphyrinogen III synthase - RNA binding motif protein 33 - replication protein A2, 32kDa - four and a half LIM domains 3 |