YIPF5-Yip1 domain family, member 5 Gene View larger

YIPF5-Yip1 domain family, member 5 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of YIPF5-Yip1 domain family, member 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about YIPF5-Yip1 domain family, member 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007829
Product type: DNA & cDNA
Ncbi symbol: YIPF5
Origin species: Human
Product name: YIPF5-Yip1 domain family, member 5 Gene
Size: 2ug
Accessions: BC007829
Gene id: 81555
Gene description: Yip1 domain family, member 5
Synonyms: protein YIPF5; FinGER5; SB140; SMAP-5; SMAP5; YIP1A; YIP1 family member 5; YPT-interacting protein 1 A; five-pass transmembrane protein localizing in the Golgi apparatus and the endoplasmic reticulum 5; golgi membrane protein SB140; smooth muscle cell associated protein 5; Yip1 domain family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcaggctttgaaaacttaaacacggatttctaccagacaagttacagcatcgatgatcagtcacagcagtcctatgattatggaggaagtggaggaccctatagcaaacagtatgctggctatgactattcgcagcaaggcagatttgtccctccagacatgatgcagccacaacagccatacaccgggcagatttaccagccaactcaggcatatactccagcttcacctcagcctttctatggaaacaactttgaggatgagccacctttattagaagagttaggtatcaattttgaccacatctggcaaaaaacactaacagtattacatccgttaaaagtagcagatggcagcatcatgaatgaaactgatttggcaggtccaatggttttttgccttgcttttggagccacattgctactggctggcaaaatccagtttggctatgtatacgggatcagtgcaattggatgtctaggaatgttttgtttattaaacttaatgagtatgacaggtgtttcatttggttgtgtggcaagtgtccttggatattgtcttctgcccatgatcctactttccagctttgcagtgatattttctttgcaaggaatggtaggaatcattctcactgctgggattattggatggtgtagtttttctgcttccaaaatatttatttctgcattagccatggaaggacagcaacttttagtagcatatccttgcgctttgttatatggagtctttgccctgatttccgtcttttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - uroporphyrinogen III synthase
- RNA binding motif protein 33
- replication protein A2, 32kDa
- four and a half LIM domains 3

Buy YIPF5-Yip1 domain family, member 5 Gene now

Add to cart