Login to display prices
Login to display prices
UROS-uroporphyrinogen III synthase Gene View larger

UROS-uroporphyrinogen III synthase Gene

PTXBC002573

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UROS-uroporphyrinogen III synthase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UROS-uroporphyrinogen III synthase Gene

Proteogenix catalog: PTXBC002573
Ncbi symbol: UROS
Product name: UROS-uroporphyrinogen III synthase Gene
Size: 2ug
Accessions: BC002573
Gene id: 7390
Gene description: uroporphyrinogen III synthase
Synonyms: UROIIIS; uroporphyrinogen-III synthase; hydroxymethylbilane hydrolyase; uroporphyrinogen-III cosynthase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggttcttttactgaaggatgcgaaggaagatgactgtggccaggatccgtatatcagggaattaggattatatggacttgaagccactttgatccctgttttatcgtttgagtttttgtctcttcccagtttctctgagaagctttctcatcctgaagattacgggggactcatttttaccagccccagagcagtggaagcagcagagttatgtttggagcaaaacaataaaactgaagtctgggaaaggtctctgaaagaaaaatggaatgccaagtcagtgtatgtggttggaaatgctactgcttctctagtgagtaaaattggcctggatacagaaggagaaacctgtggaaatgcagaaaagcttgcagaatatatttgttccagggagtcctcagcactgcctcttctatttccctgtggaaacctcaaaagagaaatcctgccaaaagcgctcaaggacaaagggattgccatggaaagcataactgtgtatcagacagttgcacacccaggaatccaagggaacctgaacagctactattcccagcagggggttccagccagcatcacattttttagtccctctggcctcacatacagtctcaagcacattcaggagttatctggtgacaatatcgatcaaattaagtttgcagccatcggccccactacggctcgcgcgctggccgcccagggccttcctgtaagctgcactgcagagagccccacgccacaagccctggccactggcatcaggaaggctctccagccccatggctgctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: