RPA2-replication protein A2, 32kDa Gene View larger

RPA2-replication protein A2, 32kDa Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPA2-replication protein A2, 32kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPA2-replication protein A2, 32kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001630
Product type: DNA & cDNA
Ncbi symbol: RPA2
Origin species: Human
Product name: RPA2-replication protein A2, 32kDa Gene
Size: 2ug
Accessions: BC001630
Gene id: 6118
Gene description: replication protein A2, 32kDa
Synonyms: REPA2; RP-A p32; RP-A p34; RPA32; replication protein A 32 kDa subunit; RF-A protein 2; replication factor A protein 2; replication protein A 34 kDa subunit; replication protein A2, 32kDa; replication protein A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaacagtggattcgaaagctatggcagctcctcatacgggggagccggcggctacacgcagtccccggggggctttggatcgcccgcaccttctcaagccgaaaagaaatcaagagcccgagcccagcacattgtgccctgtactatatctcagctgctttctgccactttggttgatgaagtgttcagaattgggaatgttgagatttcacaggtcactattgtggggatcatcagacatgcagagaaggctccaaccaacattgtttacaaaatagatgacatgacagctgcacccatggacgttcgccagtgggttgacacagatgacaccagcagtgaaaacactgtggttcctccagaaacatatgtgaaagtggcaggccacctgagatcttttcagaacaaaaagagcctggtagcctttaagatcatgcccctggaggatatgaatgagttcaccacacatattctggaagtgatcaatgcacacatggtactaagcaaagccaacagccagccctcagcagggagagcacctatcagcaatccaggaatgagtgaagcagggaactttggtgggaatagcttcatgccagcaaatggcctcactgtggcccaaaaccaggtgttgaatttgattaaggcttgtccaagacctgaagggttgaactttcaggatctcaagaaccagctgaaacacatgtctgtatcctcaatcaagcaagctgtggattttctgagcaatgaggggcacatctattctactgtggatgatgaccattttaaatccacagatgcagaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - four and a half LIM domains 3
- sulfatase modifying factor 2
- estrogen receptor 2 (ER beta)
- tumor suppressor candidate 3

Buy RPA2-replication protein A2, 32kDa Gene now

Add to cart