Login to display prices
Login to display prices
ESR2-estrogen receptor 2 (ER beta) Gene View larger

ESR2-estrogen receptor 2 (ER beta) Gene

PTXBC024181

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ESR2-estrogen receptor 2 (ER beta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ESR2-estrogen receptor 2 (ER beta) Gene

Proteogenix catalog: PTXBC024181
Ncbi symbol: ESR2
Product name: ESR2-estrogen receptor 2 (ER beta) Gene
Size: 2ug
Accessions: BC024181
Gene id: 2100
Gene description: estrogen receptor 2 (ER beta)
Synonyms: ER-BETA; ESR-BETA; ESRB; ESTRB; Erb; NR3A2; estrogen receptor beta; ER beta; estrogen receptor beta 4; nuclear receptor subfamily 3 group A member 2; estrogen receptor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatataaaaaactcaccatctagccttaattctccttcctcctacaactgcagtcaatccatcttacccctggagcacggctccatatacataccttcctcctatgtagacagccaccatgaatatccagccatgacattctatagccctgctgtgatgaattacagcattcccagcaatgtcactaacttggaaggtgggcctggtcggcagaccacaagcccaaatgtgttgtggccaacacctgggcacctttctcctttagtggtccatcgccagttatcacatctgtatgcggaacctcaaaagagtccctggtgtgaagcaagatcgctagaacacaccttacctgtaaacagagagacactgaaaaggaaggttagtgggaaccgttgcgccagccctgttactggtccaggttcaaagagggatgctcacttctgcgctgtctgcagcgattacgcatcgggatatcactatggagtctggtcgtgtgaaggatgtaaggccttttttaaaagaagcattcaaggacataatgattatatttgtccagctacaaatcagtgtacaatcgataaaaaccggcgcaagagctgccaggcctgccgacttcggaagtgttacgaagtgggaatggtgaagtgtggctcccggagagagagatgtgggtaccgccttgtgcggagacagagaagtgccgacgagcagctgcactgtgccggcaaggccaagagaagtggcggccacgcgccccgagtgcgggagctgctgctggacgccctgagccccgagcagctagtgctcaccctcctggaggctgagccgccccatgtgctgatcagccgccccagtgcgcccttcaccgaggcctccatgatgatgtccctgaccaagttggccgacaaggagttggtacacatgatcagctgggccaagaagattcccgggatgaggggaaatgcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: