ESR2-estrogen receptor 2 (ER beta) Gene View larger

ESR2-estrogen receptor 2 (ER beta) Gene

PTXBC024181

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ESR2-estrogen receptor 2 (ER beta) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ESR2-estrogen receptor 2 (ER beta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC024181
Product type: DNA & cDNA
Ncbi symbol: ESR2
Origin species: Human
Product name: ESR2-estrogen receptor 2 (ER beta) Gene
Size: 2ug
Accessions: BC024181
Gene id: 2100
Gene description: estrogen receptor 2 (ER beta)
Synonyms: ER-BETA; ESR-BETA; ESRB; ESTRB; Erb; NR3A2; estrogen receptor beta; ER beta; estrogen receptor beta 4; nuclear receptor subfamily 3 group A member 2; estrogen receptor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatataaaaaactcaccatctagccttaattctccttcctcctacaactgcagtcaatccatcttacccctggagcacggctccatatacataccttcctcctatgtagacagccaccatgaatatccagccatgacattctatagccctgctgtgatgaattacagcattcccagcaatgtcactaacttggaaggtgggcctggtcggcagaccacaagcccaaatgtgttgtggccaacacctgggcacctttctcctttagtggtccatcgccagttatcacatctgtatgcggaacctcaaaagagtccctggtgtgaagcaagatcgctagaacacaccttacctgtaaacagagagacactgaaaaggaaggttagtgggaaccgttgcgccagccctgttactggtccaggttcaaagagggatgctcacttctgcgctgtctgcagcgattacgcatcgggatatcactatggagtctggtcgtgtgaaggatgtaaggccttttttaaaagaagcattcaaggacataatgattatatttgtccagctacaaatcagtgtacaatcgataaaaaccggcgcaagagctgccaggcctgccgacttcggaagtgttacgaagtgggaatggtgaagtgtggctcccggagagagagatgtgggtaccgccttgtgcggagacagagaagtgccgacgagcagctgcactgtgccggcaaggccaagagaagtggcggccacgcgccccgagtgcgggagctgctgctggacgccctgagccccgagcagctagtgctcaccctcctggaggctgagccgccccatgtgctgatcagccgccccagtgcgcccttcaccgaggcctccatgatgatgtccctgaccaagttggccgacaaggagttggtacacatgatcagctgggccaagaagattcccgggatgaggggaaatgcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tumor suppressor candidate 3
- kelch domain containing 8A
- period homolog 3 (Drosophila)
- PAK1 interacting protein 1

Buy ESR2-estrogen receptor 2 (ER beta) Gene now

Add to cart