PER3-period homolog 3 (Drosophila) Gene View larger

PER3-period homolog 3 (Drosophila) Gene

PTXBC026102

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PER3-period homolog 3 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PER3-period homolog 3 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026102
Product type: DNA & cDNA
Ncbi symbol: PER3
Origin species: Human
Product name: PER3-period homolog 3 (Drosophila) Gene
Size: 2ug
Accessions: BC026102
Gene id: 8863
Gene description: period homolog 3 (Drosophila)
Synonyms: FASPS3; GIG13; period circadian protein homolog 3; cell growth-inhibiting gene 13 protein; circadian clock protein PERIOD 3; hPER3; period circadian protein 3; period circadian clock 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccgcggggaagctcctggccccgggagacggggggctaaggacgaggccctgggcgaagaatcgggggagcggtggagccccgagttccatctgcagaggaaattggcggacagcagccacagtgaacagcaagatcgaaacagagtttctgaagaacttatcatggttgtccaagaaatgaaaaaatacttcccctcggagagacgcaataaaccaagcactctagatgccctcaactatgctctccgctgtgtccacagcgttcaagcaaacagtgagtttttccagattctcagtcagaatggagcacctcaggcagatgtgagcatgtacagtcttgaggagctggccactatcgcttcagaacacacttccaaaaacacagatacctttgtggcagtattttcatttctgtctggaaggttagtgcacatttctgaacaggctgctttgatcctgaatcgtaagaaagatgtcctggcgtcttctcactttgttgacctgcttgcacctcaagacatgagggtattctacgcgcacactgccagagctcagcttcctttctggaacaactggacccaaagagctgcacggtatgaatgtgctccggtgaaaccttttttctgcaggatccgtggaggtgaagacagaaagcaagagaagtgtcactccccattccggatcatcccctatctgattcatgtacatcaccctgcccagccagaattggaatcggaaccttgctgtctcactgtggttgaaaagattcactctggttatgaagctcctcggatcccagtgaataaaagaatcttcaccaccacacacaccccagggtgtgtttttcttgaagtagatgaaaaagcagtgcctttgctgggttacctacctcaggacctgattggaacatcgatcctaagctacctgcaccctgaagatcgttctctgatggttgccatacaccaaaaagttttgaagtatgcagggcatcctccctttgaacattctcccattcgattttgtactcaaaacggagactacatcatactggattccagttggtccagctttgtgaatccctggagccggaagatttctttcatcattggtcggcataaagttcgaacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PAK1 interacting protein 1
- dom-3 homolog Z (C. elegans)
- RNA binding motif protein 23
- interferon gamma receptor 1

Buy PER3-period homolog 3 (Drosophila) Gene now

Add to cart