RBM33-RNA binding motif protein 33 Gene View larger

RBM33-RNA binding motif protein 33 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM33-RNA binding motif protein 33 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBM33-RNA binding motif protein 33 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011923
Product type: DNA & cDNA
Ncbi symbol: RBM33
Origin species: Human
Product name: RBM33-RNA binding motif protein 33 Gene
Size: 2ug
Accessions: BC011923
Gene id: 155435
Gene description: RNA binding motif protein 33
Synonyms: PRR8; RNA-binding protein 33; proline rich 8; proline-rich protein 8; RNA binding motif protein 33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgccctgggagcgagcggaggagcaggcgccggagatgatgactttgaccagtttgataagcctggcgcggaacggtcgtggagaagaagagctgctgatgaggactgggacagtgaacttgaagatgatttacttggagaagatttgctatctggcaaaaagaatcagtcggatttgtcagatgaagagctaaatgatgatcttttgcagagtgataatgaagatgaagaaaatttcagttctcagggtgttacaattagtctgaatgctacatctggcatggttacatcatttgaactctctgacaacactaacgaccaatctggagaacaggaatctgagtatgaacaagaacaaggagaggatgaactggtttatcacaaatctgatggatcagaattgtatactcaagagtacccagaagaaggacagtatgaaggccacgaagctgagttgacagaagaccaaatagaatatgtggaagagccagaggaggagcagctttacactgatgaagtgttagacatcgagatcaatgaacctttagatgaatttacaggaggtatggaaacattggaacttcaaaaggacatcaaagaagaatcagatgaagaagaagaagatgatgaagaatctggacgattacgtttcaaaactgaaaggaaagaaggaacaattattaggctctcagatgtaactagagagagaaggaacattccagaaactttgggtaacttttttgcctgtctcccatcctcctttactctcatttcaacttcctccatagtattgctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - replication protein A2, 32kDa
- four and a half LIM domains 3
- sulfatase modifying factor 2
- estrogen receptor 2 (ER beta)

Buy RBM33-RNA binding motif protein 33 Gene now

Add to cart