Login to display prices
Login to display prices
RBM33-RNA binding motif protein 33 Gene View larger

RBM33-RNA binding motif protein 33 Gene

PTXBC011923

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBM33-RNA binding motif protein 33 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBM33-RNA binding motif protein 33 Gene

Proteogenix catalog: PTXBC011923
Ncbi symbol: RBM33
Product name: RBM33-RNA binding motif protein 33 Gene
Size: 2ug
Accessions: BC011923
Gene id: 155435
Gene description: RNA binding motif protein 33
Synonyms: PRR8; RNA-binding protein 33; proline rich 8; proline-rich protein 8; RNA binding motif protein 33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgccctgggagcgagcggaggagcaggcgccggagatgatgactttgaccagtttgataagcctggcgcggaacggtcgtggagaagaagagctgctgatgaggactgggacagtgaacttgaagatgatttacttggagaagatttgctatctggcaaaaagaatcagtcggatttgtcagatgaagagctaaatgatgatcttttgcagagtgataatgaagatgaagaaaatttcagttctcagggtgttacaattagtctgaatgctacatctggcatggttacatcatttgaactctctgacaacactaacgaccaatctggagaacaggaatctgagtatgaacaagaacaaggagaggatgaactggtttatcacaaatctgatggatcagaattgtatactcaagagtacccagaagaaggacagtatgaaggccacgaagctgagttgacagaagaccaaatagaatatgtggaagagccagaggaggagcagctttacactgatgaagtgttagacatcgagatcaatgaacctttagatgaatttacaggaggtatggaaacattggaacttcaaaaggacatcaaagaagaatcagatgaagaagaagaagatgatgaagaatctggacgattacgtttcaaaactgaaaggaaagaaggaacaattattaggctctcagatgtaactagagagagaaggaacattccagaaactttgggtaacttttttgcctgtctcccatcctcctttactctcatttcaacttcctccatagtattgctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: