REEP6-receptor accessory protein 6 Gene View larger

REEP6-receptor accessory protein 6 Gene

PTXBC008201

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of REEP6-receptor accessory protein 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about REEP6-receptor accessory protein 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008201
Product type: DNA & cDNA
Ncbi symbol: REEP6
Origin species: Human
Product name: REEP6-receptor accessory protein 6 Gene
Size: 2ug
Accessions: BC008201
Gene id: 92840
Gene description: receptor accessory protein 6
Synonyms: C19orf32; DP1L1; TB2L1; Yip2f; receptor expression-enhancing protein 6; deleted in polyposis 1-like 1; polyposis locus protein 1-like 1; receptor accessory protein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacggcctgaggcagcgcgtggagcacttcctggagcaaaggaacctggtcaccgaagtgctgggggcgctggaggccaagaccggggtggagaagcggtatctggctgcaggagccgtcactctgctaagcctgtatctgctgttcggctacggagcgtctctgctgtgcaatctcatcggatttgtgtaccccgcatatgcctcaatcaaagctatcgagagcccaagcaaggacgacgacactgtgtggctcacctactgggtggtgtacgccctgtttgggctggccgagttcttcagcgatctactcctgtcctggttccctttctactacgtgggcaagtgcgccttcctgttgttctgcatggctcccaggccctggaacggggctctcatgctgtatcagcgcgtcgtgcgtccgctgttcctaaggcaccacggggccgtagacagaatcatgaacgacctcagcgggcgagccctggacgcggcggccggaataaccaggaacgtcaagccaagccagaccccgcagccgaaggacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stromal cell-derived factor 2
- RING1 and YY1 binding protein
- Yip1 domain family, member 6
- canopy 4 homolog (zebrafish)

Buy REEP6-receptor accessory protein 6 Gene now

Add to cart