Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of REEP6-receptor accessory protein 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about REEP6-receptor accessory protein 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008201 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | REEP6 |
| Origin species: | Human |
| Product name: | REEP6-receptor accessory protein 6 Gene |
| Size: | 2ug |
| Accessions: | BC008201 |
| Gene id: | 92840 |
| Gene description: | receptor accessory protein 6 |
| Synonyms: | C19orf32; DP1L1; TB2L1; Yip2f; receptor expression-enhancing protein 6; deleted in polyposis 1-like 1; polyposis locus protein 1-like 1; receptor accessory protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacggcctgaggcagcgcgtggagcacttcctggagcaaaggaacctggtcaccgaagtgctgggggcgctggaggccaagaccggggtggagaagcggtatctggctgcaggagccgtcactctgctaagcctgtatctgctgttcggctacggagcgtctctgctgtgcaatctcatcggatttgtgtaccccgcatatgcctcaatcaaagctatcgagagcccaagcaaggacgacgacactgtgtggctcacctactgggtggtgtacgccctgtttgggctggccgagttcttcagcgatctactcctgtcctggttccctttctactacgtgggcaagtgcgccttcctgttgttctgcatggctcccaggccctggaacggggctctcatgctgtatcagcgcgtcgtgcgtccgctgttcctaaggcaccacggggccgtagacagaatcatgaacgacctcagcgggcgagccctggacgcggcggccggaataaccaggaacgtcaagccaagccagaccccgcagccgaaggacaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - stromal cell-derived factor 2 - RING1 and YY1 binding protein - Yip1 domain family, member 6 - canopy 4 homolog (zebrafish) |