SDF2-stromal cell-derived factor 2 Gene View larger

SDF2-stromal cell-derived factor 2 Gene

PTXBC000500

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SDF2-stromal cell-derived factor 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SDF2-stromal cell-derived factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000500
Product type: DNA & cDNA
Ncbi symbol: SDF2
Origin species: Human
Product name: SDF2-stromal cell-derived factor 2 Gene
Size: 2ug
Accessions: BC000500
Gene id: 6388
Gene description: stromal cell-derived factor 2
Synonyms: stromal cell-derived factor 2; SDF-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtagtacctctgctgttgttggggggtttgtggagcgctgtgggagcgtccagcctgggtgtcgttacttgcggctccgtggtgaagctactcaatacgcgccacaacgtccgactgcactcacacgacgtgcgctatgggtcaggtagtgggcagcagtcagtgacaggtgtaacctctgtggatgacagcaacagttactggaggatacgggggaagagtgccacagtgtgtgagaggggaacccccatcaagtgtggccagcccatccggctgacacatgtcaacactggccgaaacctccatagtcaccacttcacttcacctctttctggaaaccaggaagtgagtgcttttggtgaggaaggtgaaggtgattatctggatgactggacagtgctctgtaatggaccctactgggtgagagatggtgaggtgcggttcaaacactcttccactgaggtactgctgtctgtcacaggagaacaatatggtcgacctatcagtgggcaaaaagaggtgcatggcatggcccagccaagtcagaacaactactggaaagccatggaaggcatcttcatgaagcccagtgagttgttgaaggcagaagcccaccatgcagagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RING1 and YY1 binding protein
- Yip1 domain family, member 6
- canopy 4 homolog (zebrafish)
- Yip1 domain family, member 5

Buy SDF2-stromal cell-derived factor 2 Gene now

Add to cart