PTXBC014959
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014959 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RYBP |
| Origin species: | Human |
| Product name: | RYBP-RING1 and YY1 binding protein Gene |
| Size: | 2ug |
| Accessions: | BC014959 |
| Gene id: | 23429 |
| Gene description: | RING1 and YY1 binding protein |
| Synonyms: | ring1 interactor RYBP; AAP1; APAP-1; DEDAF; YEAF1; RING1 and YY1-binding protein; DED-associated factor; YY1 and E4TF1 associated factor 1; apoptin-associating protein 1; death effector domain-associated factor; RING1 and YY1 binding protein |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccatgggcgacaagaagagcccgaccaggccaaaaagacaagcgaaacctgccgcagacgaagggttttgggattgtagcgtctgcaccttcagaaacagtgctgaagcctttaaatgcagcatctgcgatgtgaggaaaggcacctccaccagaaaacctcggatcaattctcagctggtggcgcaacaagtggcacaacagtatgccaccccaccaccccctaaaaaggagaagaaggagaaagttgaaaagcaggacaaagagaaacctgagaaagacaaggaaattagtcctagtgttaccaagaaaaataccaacaagaaaaccaaaccaaagtctgacattctgaaagatcctcctagtgaagcaaacagcatacagtctgcaaatgctacaacaaagaccagcgaaacaaatcacacctcaaggccccggctgaaaaacgtggacaggagcactgcacagcagttggcagtaactgtgggcaacgtcaccgtcattatcacagactttaaggaaaagactcgctcctcatcgacatcctcatccacagtgacctccagtgcagggtcagaacagcagaaccagagcagctcggggtcagagagcacagacaagggctcctcccgttcctccacgccaaagggcgacatgtcagcagtcaatgatgaatctttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - Yip1 domain family, member 6 - canopy 4 homolog (zebrafish) - Yip1 domain family, member 5 - uroporphyrinogen III synthase |