Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ID1-inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Gene
PTXBC000613
New product
Data sheet of ID1-inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ID1-inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000613 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ID1 |
| Origin species: | Human |
| Product name: | ID1-inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Gene |
| Size: | 2ug |
| Accessions: | BC000613 |
| Gene id: | 3397 |
| Gene description: | inhibitor of DNA binding 1, dominant negative helix-loop-helix protein |
| Synonyms: | bHLHb24; DNA-binding protein inhibitor ID-1; class B basic helix-loop-helix protein 24; dJ857M17.1.2 (inhibitor of DNA binding 1, dominant negative helix-loop-helix protein); inhibitor of DNA binding 1, dominant negative helix-loop-helix protein; inhibitor of differentiation 1; inhibitor of DNA binding 1, HLH protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacgagcagcaggtaaacgtgctgctctacgacatgaacggctgttactcacgcctcaaggagctggtgcccaccctgccccagaaccgcaaggtgagcaaggtggagattctccagcacgtcatcgactacatcagggaccttcagttggagctgaactcggaatccgaagttggaacccccgggggccgagggctgccggtccgggctccgctcagcaccctcaacggcgagatcagcgccctgacggccgaggcggcatgcgttcctgcggacgatcgcatcttgtgtcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) - processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) - potassium voltage-gated channel, subfamily H (eag-related), member 6 |