Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FUT2-fucosyltransferase 2 (secretor status included) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUT2-fucosyltransferase 2 (secretor status included) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUT2 |
| Origin species: | Human |
| Product name: | FUT2-fucosyltransferase 2 (secretor status included) Gene |
| Size: | 2ug |
| Accessions: | BC001899 |
| Gene id: | 2524 |
| Gene description: | fucosyltransferase 2 (secretor status included) |
| Synonyms: | B12QTL1; SEC2; Se2; sej; galactoside 2-alpha-L-fucosyltransferase 2; GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2; alpha (1,2) fucosyltransferase; alpha(1,2)FT 2; alpha(1,2)FT2; fucosyltransferase 2 (secretor status included); galactoside 2-L-fucosyltransferase; secretor blood group alpha-2-fucosyltransferase; secretor factor; fucosyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggtcgttcagatgcctttctcctttcccatggcccacttcatcctctttgtctttacggtttccactatatttcacgttcagcagcggctagcgaagattcaagccatgtgggagttaccggtgcagataccagtgctagcctcaacatcaaaggcactgggacccagccagctcagggggatgtggacgatcaatgcgataggccgcctggggaaccagatgggcgagtacgccacactgtatgccctggccaagatgaacgggcggcccgccttcatcccggcccagatgcacagcaccctggcccccatcttcagaatcaccctgccggtgctgcacagcgccacggccagcaggatcccctggcagaactaccacctgaacgactggatggaggaggaataccgccacatcccgggggagtacgtccgcttcaccggctacccctgctcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 12 - DiGeorge syndrome critical region gene 6-like - splicing factor, arginine/serine-rich 7, 35kDa - nicotinamide nucleotide adenylyltransferase 1 |