Login to display prices
Login to display prices
FUT2-fucosyltransferase 2 (secretor status included) Gene View larger

FUT2-fucosyltransferase 2 (secretor status included) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUT2-fucosyltransferase 2 (secretor status included) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FUT2-fucosyltransferase 2 (secretor status included) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001899
Product type: DNA & cDNA
Ncbi symbol: FUT2
Origin species: Human
Product name: FUT2-fucosyltransferase 2 (secretor status included) Gene
Size: 2ug
Accessions: BC001899
Gene id: 2524
Gene description: fucosyltransferase 2 (secretor status included)
Synonyms: B12QTL1; SEC2; Se2; sej; galactoside 2-alpha-L-fucosyltransferase 2; GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2; alpha (1,2) fucosyltransferase; alpha(1,2)FT 2; alpha(1,2)FT2; fucosyltransferase 2 (secretor status included); galactoside 2-L-fucosyltransferase; secretor blood group alpha-2-fucosyltransferase; secretor factor; fucosyltransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggtcgttcagatgcctttctcctttcccatggcccacttcatcctctttgtctttacggtttccactatatttcacgttcagcagcggctagcgaagattcaagccatgtgggagttaccggtgcagataccagtgctagcctcaacatcaaaggcactgggacccagccagctcagggggatgtggacgatcaatgcgataggccgcctggggaaccagatgggcgagtacgccacactgtatgccctggccaagatgaacgggcggcccgccttcatcccggcccagatgcacagcaccctggcccccatcttcagaatcaccctgccggtgctgcacagcgccacggccagcaggatcccctggcagaactaccacctgaacgactggatggaggaggaataccgccacatcccgggggagtacgtccgcttcaccggctacccctgctcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily C, member 12
- DiGeorge syndrome critical region gene 6-like
- splicing factor, arginine/serine-rich 7, 35kDa
- nicotinamide nucleotide adenylyltransferase 1