Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene
PTXBC000018
New product
Data sheet of ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000018 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARPC5L |
| Origin species: | Human |
| Product name: | ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene |
| Size: | 2ug |
| Accessions: | BC000018 |
| Gene id: | 81873 |
| Gene description: | actin related protein 2/3 complex, subunit 5-like |
| Synonyms: | ARC16-2; actin-related protein 2/3 complex subunit 5-like protein; arp2/3 complex 16 kDa subunit 2; actin related protein 2/3 complex subunit 5 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccggaacacgctgtcctcgcgcttccgccgggtggacatcgacgaatttgacgagaacaaatttgtggacgagcaggaggaggcggcggcggcggcggcggagccaggcccggacccgagcgaggtggacgggctcctgcggcaaggggacatgcttcgggcattccatgcagccttgcggaactctcccgtcaacaccaagaatcaagctgtgaaggagcgagcccagggcgtggtgctgaaagtgctcacaaacttcaagagcagtgagattgagcaggctgtgcagtcactggacagaaacggcgttgacttgttaatgaagtacatttataaaggctttgagaagcccacagaaaatagcagcgcagtgttactccagtggcacgaaaaggccttagcagtaggaggactaggctccattataagagttcttacagcaagaaagactgttt |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CCHC-type zinc finger, nucleic acid binding protein - holocytochrome c synthase (cytochrome c heme-lyase) - basic leucine zipper transcription factor, ATF-like - phorbol-12-myristate-13-acetate-induced protein 1 |