Login to display prices
Login to display prices
ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene View larger

ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene

PTXBC000018

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene

Proteogenix catalog: PTXBC000018
Ncbi symbol: ARPC5L
Product name: ARPC5L-actin related protein 2/3 complex, subunit 5-like Gene
Size: 2ug
Accessions: BC000018
Gene id: 81873
Gene description: actin related protein 2/3 complex, subunit 5-like
Synonyms: ARC16-2; actin-related protein 2/3 complex subunit 5-like protein; arp2/3 complex 16 kDa subunit 2; actin related protein 2/3 complex subunit 5 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccggaacacgctgtcctcgcgcttccgccgggtggacatcgacgaatttgacgagaacaaatttgtggacgagcaggaggaggcggcggcggcggcggcggagccaggcccggacccgagcgaggtggacgggctcctgcggcaaggggacatgcttcgggcattccatgcagccttgcggaactctcccgtcaacaccaagaatcaagctgtgaaggagcgagcccagggcgtggtgctgaaagtgctcacaaacttcaagagcagtgagattgagcaggctgtgcagtcactggacagaaacggcgttgacttgttaatgaagtacatttataaaggctttgagaagcccacagaaaatagcagcgcagtgttactccagtggcacgaaaaggccttagcagtaggaggactaggctccattataagagttcttacagcaagaaagactgttt
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: