Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of NPC2-Niemann-Pick disease, type C2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NPC2-Niemann-Pick disease, type C2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002532 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NPC2 |
| Origin species: | Human |
| Product name: | NPC2-Niemann-Pick disease, type C2 Gene |
| Size: | 2ug |
| Accessions: | BC002532 |
| Gene id: | 10577 |
| Gene description: | Niemann-Pick disease, type C2 |
| Synonyms: | EDDM1; HE1; epididymal secretory protein E1; Niemann-Pick disease type C2 protein; Niemann-Pick disease, type C2; epididymal protein 1; human epididymis-specific protein 1; tissue-specific secretory protein; NPC intracellular cholesterol transporter 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtttcctggcagctacattcctgctcctggcgctcagcaccgctgcccaggccgaaccggtgcagttcaaggactgcggttctgtggatggagttataaaggaagtgaatgtgagcccatgccccacccaaccctgccagctgagcaaaggacagtcttacagcgtcaatgtcaccttcaccagcaatattcagtctaaaagcagcaaggccgtggtgcatggcatcctgatgggcgtcccagttccctttcccattcctgagcctgatggttgtaagagtggaattaactgccctatccaaaaagacaagacctatagctacctgaataaactaccagtgaaaagcgaatatccctctataaaactggtggtggagtggcaacttcaggatgacaaaaaccaaagtctcttctgctgggaaatcccagtacagatcgtttctcatctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - collagen, type XX, alpha 1 - receptor accessory protein 6 - stromal cell-derived factor 2 - RING1 and YY1 binding protein |