Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PYCARD-PYD and CARD domain containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PYCARD-PYD and CARD domain containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013569 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PYCARD |
| Origin species: | Human |
| Product name: | PYCARD-PYD and CARD domain containing Gene |
| Size: | 2ug |
| Accessions: | BC013569 |
| Gene id: | 29108 |
| Gene description: | PYD and CARD domain containing |
| Synonyms: | CARD5; TMS; TMS-1; TMS1; apoptosis-associated speck-like protein containing a CARD; caspase recruitment domain-containing protein 5; target of methylation-induced silencing 1; PYD and CARD domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgccttggacctcaccgacaagctggtcagcttctacctggagacctacggcgccgagctcaccgctaacgtgctgcgcgacatgggcctgcaggagatggccgggcagctgcaggcggccacgcaccagggctctggagccgcgccagctgggatccaggcccctcctcagtcggcagccaagccaggcctgcactttatagaccagcaccgggctgcgcttatcgcgagggtcacaaacgttgagtggctgctggatgctctgtacgggaaggtcctgacggatgagcagtaccaggcagtgcgggccgagcccaccaacccaagcaagatgcggaagctcttcagtttcacaccagcctggaactggacctgcaaggacttgctcctccaggccctaagggagtcccagtcctacctggtggaggacctggagcggagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin specific peptidase 47 - synovial sarcoma, X breakpoint 2 - ADP-ribosylation factor-like 4A - ADP-ribosylation factor-like 4D |