Login to display prices
Login to display prices
RNF24-ring finger protein 24 Gene View larger

RNF24-ring finger protein 24 Gene

PTXBC000213

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF24-ring finger protein 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF24-ring finger protein 24 Gene

Proteogenix catalog: PTXBC000213
Ncbi symbol: RNF24
Product name: RNF24-ring finger protein 24 Gene
Size: 2ug
Accessions: BC000213
Gene id: 11237
Gene description: ring finger protein 24
Synonyms: G1L; RING finger protein 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcggatttcccacattacaacttcaggatgcctaatattggattccagaatctgcctctcaacatatatattgtggtttttggtactgctatatttgtcttcatccttagtttactcttctgttgctacttgattaggctaagacatcaagcacacaaagaattttatgcctacaaacaggttatattaaaagagaaagtaaaagaattgaatttacatgagctctgtgcagtgtgcctagaagacttcaagcctcgagatgagttggggatttgcccatgtaagcacgccttccacagaaagtgccttattaagtggctggaggttcgtaaagtgtgtcccctgtgcaacatgccagttctacagctggcccagttgcacagtaagcaggaccgtggaccccctcaggggccccttcctggggcagagaacattgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: