RNF24-ring finger protein 24 Gene View larger

RNF24-ring finger protein 24 Gene

PTXBC000213

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF24-ring finger protein 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF24-ring finger protein 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000213
Product type: DNA & cDNA
Ncbi symbol: RNF24
Origin species: Human
Product name: RNF24-ring finger protein 24 Gene
Size: 2ug
Accessions: BC000213
Gene id: 11237
Gene description: ring finger protein 24
Synonyms: G1L; RING finger protein 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcggatttcccacattacaacttcaggatgcctaatattggattccagaatctgcctctcaacatatatattgtggtttttggtactgctatatttgtcttcatccttagtttactcttctgttgctacttgattaggctaagacatcaagcacacaaagaattttatgcctacaaacaggttatattaaaagagaaagtaaaagaattgaatttacatgagctctgtgcagtgtgcctagaagacttcaagcctcgagatgagttggggatttgcccatgtaagcacgccttccacagaaagtgccttattaagtggctggaggttcgtaaagtgtgtcccctgtgcaacatgccagttctacagctggcccagttgcacagtaagcaggaccgtggaccccctcaggggccccttcctggggcagagaacattgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 44
- male-enhanced antigen 1
- dihydrofolate reductase
- heme binding protein 2

Buy RNF24-ring finger protein 24 Gene now

Add to cart