ZNF44-zinc finger protein 44 Gene View larger

ZNF44-zinc finger protein 44 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF44-zinc finger protein 44 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF44-zinc finger protein 44 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032246
Product type: DNA & cDNA
Ncbi symbol: ZNF44
Origin species: Human
Product name: ZNF44-zinc finger protein 44 Gene
Size: 2ug
Accessions: BC032246
Gene id: 51710
Gene description: zinc finger protein 44
Synonyms: GIOT-2; KOX7; ZNF; ZNF504; ZNF55; ZNF58; zinc finger protein 44; gonadotropin inducible transcription repressor-2; gonadotropin-inducible ovary transcription repressor 2; zinc finger protein 55; zinc finger protein 58; zinc finger protein KOX7; zinc finger protein ZnFP12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgtgttatggaactttctggggctaccctaagatgctggaagctgccaatctcatggagggcctagtggatatcggcccttgggtcactcttcccagaggacagcctgaggtgttggagtggggcctcccaaaggatcaggactcagtggcctttgaggatgtggctgtgaacttcacccatgaggagtgggctttgctgggtccatcacagaagaatctctacagagatgtgatgcgagaaaccattaggaacctgaactgtataggaatgaaatgggaaaaccagaacattgatgatcagcaccaaaatctcaggagaaatccaaggttatcggagacatggttacagaatttcattttgatccattatggtcacctggtagctttgtctgatggaggtttgttacagttttcaacaggacagggtctccctgtcacccaggctggagttcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - male-enhanced antigen 1
- dihydrofolate reductase
- heme binding protein 2
- homeobox containing 1

Buy ZNF44-zinc finger protein 44 Gene now

Add to cart