HEBP2-heme binding protein 2 Gene View larger

HEBP2-heme binding protein 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEBP2-heme binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HEBP2-heme binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008205
Product type: DNA & cDNA
Ncbi symbol: HEBP2
Origin species: Human
Product name: HEBP2-heme binding protein 2 Gene
Size: 2ug
Accessions: BC008205
Gene id: 23593
Gene description: heme binding protein 2
Synonyms: C6ORF34B; C6orf34; PP23; heme-binding protein 2; placental protein 23; heme binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagccgctccagccagaccccggggcggccgaggacgcggcggcccaagctgtggagacgccgggctggaaggccccggaggacgccggcccccagcccggaagttatgagatccgacactatggaccagccaagtgggtcagcacgtccgtggagtctatggactgggattcagccatccagacgggctttacgaaactgaacagctacattcaaggcaaaaacgagaaagagatgaaaataaagatgacagctccagtgacaagctacgtggagcctggttcaggtccttttagtgagtctaccattaccatttccctgtatattccctctgaacagcaatttgatccacccaggcctttagagtcagatgtcttcattgaagatagagccgaaatgactgtgtttgtacggtctttcgatggattttctagtgcccaaaagaatcaagaacaacttttgacattagcaagcattttaagggaagatggaaaagttttcgatgagaaggtttactacactgcaggctacaacagtcctgtcaaattgcttaatagaaataatgaagtgtggttgattcaaaaaaatgaacccaccaaagaaaacgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - homeobox containing 1
- Z-DNA binding protein 1
- zinc finger protein 24
- Meckel syndrome, type 1

Buy HEBP2-heme binding protein 2 Gene now

Add to cart