MKS1-Meckel syndrome, type 1 Gene View larger

MKS1-Meckel syndrome, type 1 Gene

PTXBC010061

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MKS1-Meckel syndrome, type 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MKS1-Meckel syndrome, type 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010061
Product type: DNA & cDNA
Ncbi symbol: MKS1
Origin species: Human
Product name: MKS1-Meckel syndrome, type 1 Gene
Size: 2ug
Accessions: BC010061
Gene id: 54903
Gene description: Meckel syndrome, type 1
Synonyms: BBS13; JBTS28; MES; MKS; POC12; Meckel syndrome type 1 protein; POC12 centriolar protein homolog; Meckel syndrome, type 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccactgcagccagcgaggtgccttcattcttggtcgagcgaatggcaaatgtcaggcgtcgccggcaggacaggcgagggatggagggcggcatcctcaagtcacgcatcgtcacctgggagccctcagaagagtttgtcaggaacaaccacgtcattaacacccctcttcagacaatgcacatcatggcagacctggggccctataaaaagcttggctataagaagtatgaacatgtcctgtgtactctgaaggtggatagcaatggtgtgatcacagtaaagcctgacttcacgggcctcaaaggaccctacaggattgagacggagggggagaagcaggagctgtggaaatatacgatcgacaatgtttccccccacgcacagccggaggaggaggagcgggaacggcgagtgttcaaggatctttatggccggcacaaggagtatctcagcagcctcgtaggcaccgactttgagatgactgtcccaggtgccctccggctctttgtaaatggagaggtcgtttcagcccaaggctatgagtatgacaatctctacgtccacttctttgtagaattgccaactgctcactggtcaagcccagcattccagcagctctcaggagtaacacagacctgcaccaccaagtccctggcaatggacaaggtggctcacttctcctacccattcacgtttgaagccttcttcctccatgaggatgaatcttctgatgcactcccggagtggcctgtgctctactgtgaggtcctctcgctggacttctggcagaggtaccgtgtggaaggctatggggctgtggtgctgcctgccactccaggctcacacaccctgacagtctccacgtggagacctgtggagcttggcacggtggctgagctgaggaggtttttcattggcggttctctggaactggaggacctctcctatgtacggataccaggatccttcaagggcctttcatcttccaagaccaaagaaggaaggaaggtggacggtgagagggtcttaaatccccagcctgtgagtctcagcctctttccagggaagcctcattctactgcttggggcttgctgaggttgagatatgagttatttctgagtaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WNT inhibitory factor 1
- ring finger protein 13
- RAN binding protein 3
- NFKB activating protein

Buy MKS1-Meckel syndrome, type 1 Gene now

Add to cart