Login to display prices
Login to display prices
RNF13-ring finger protein 13 Gene View larger

RNF13-ring finger protein 13 Gene

PTXBC009781

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF13-ring finger protein 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF13-ring finger protein 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009781
Product type: DNA & cDNA
Ncbi symbol: RNF13
Origin species: Human
Product name: RNF13-ring finger protein 13 Gene
Size: 2ug
Accessions: BC009781
Gene id: 11342
Gene description: ring finger protein 13
Synonyms: E3 ubiquitin-protein ligase RNF13; RZF; RING zinc finger protein; ring finger protein 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgctctccatagggatgctcatgctgtcagccacacaagtctacaccatcttgactgtccagctctttgcattcttaaacctactgcctgtagaagcagacattttagcatataactttgaaaatgcatctcagacatttgatgacctccctgcaagatttggttatagacttccagctgaaggtttaaagggttttttgattaactcaaaaccagagaatgcctgtgaacccatagtgcctccaccagtaaaagacaattcatctggcactttcatcgtgttaattagaagacttgattgtaattttgatataaaggttttaaatgcacagagagcaggatacaaggcagccatagttcacaatgttgattctgatgacctcattagcatgggatccaacgacattgaggtactaaagaaaattgacattccatctgtctttattggtgaatcatcagctaattctctgaaagatgaattcacatatgaaaaagggggccaccttatcttagttccagaatttagtcttcctttggaatactacctaattcccttccttatcatagtgggcatctgtctcatcttgatagtcattttcatgatcacaaaatttgtccaggatagacatagagctagaagaaacagacttcgtaaagatcaacttaagaaacttcctgtacataaattcaagaaaggagatgagtatgatgtatgtgccatttgtttggatgagtatgaagatggagacaaactcagaatccttccctgttcccatgcttatcattgcaagtgtgtagacccttggctaactaaaaccaaaaaaacctgtccagtgtgcaagcaaaaagttgttccttctcaaggcgattcagactctgacacagacagtagtcaagaagaaaatgaagtgacagaacatacccctttactgagacctttagcttctgtcagtgcccagtcatttggggctttatcggaatcccgctcacatcagaacatgacagaatcttcagactatgaggaagacgacaatgaagatactgacagtagtgatgcagaaaatgaaattaatgaacatgatgtcgtggtccagttgcagcctaatggtgaacgggattacaacatagcaaatactgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAN binding protein 3
- NFKB activating protein
- RuvB-like 2 (E. coli)
- neurofibromin 2 (merlin)