Login to display prices
Login to display prices
ZNF24-zinc finger protein 24 Gene View larger

ZNF24-zinc finger protein 24 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF24-zinc finger protein 24 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF24-zinc finger protein 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003566
Product type: DNA & cDNA
Ncbi symbol: ZNF24
Origin species: Human
Product name: ZNF24-zinc finger protein 24 Gene
Size: 2ug
Accessions: BC003566
Gene id: 7572
Gene description: zinc finger protein 24
Synonyms: KOX17; RSG-A; ZNF191; ZSCAN3; Zfp191; zinc finger protein 24; retinoic acid suppression protein A; zinc finger and SCAN domain-containing protein 3; zinc finger protein 191; zinc finger protein 24 (KOX 17); zinc finger protein KOX17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcacagtcagtggaagaagattcaatacttatcatcccaactccagatgaagaggaaaaaattctgagagtgaagttggaggaggatcctgatggcgaagagggatcaagtatcccctggaaccatctcccagacccagagattttccgacagcgattcaggcagtttggataccaggattcacctgggccccgtgaggctgtgagccagctccgagaactttgccgtctgtggctcaggccagagacgcacacaaaagaacaaatcttggagctggtagtgctggagcagtttgttgccatcctacccaaagagctacagacttgggttcgagatcatcatccagagaatggagaggaggcagtgacagtgctggaggatttggagagtgaacttgatgaccctggacaaccggtttctctccgtcgacgaaaacgggaagtactagtagaagacatggtatctcaagaagaagctcagggattaccaagttctgagcttgatgctgtggagaaccagctcaagtgggcatcctgggagctccattccctaaggcactgtgatgatgatggtaggactgaaaatggagcactagctccaaagcaggagcttccttcagcattagaatcccatgaagttcctggcactctcagtatgggtgttcctcaaatttttaaatatggagaaacctgtttccccaagggcaggtttgaaagaaagagaaatccctctcgaaagaaacaacatatatgtgatgaatgtggaaaacacttcagtcagggctcagcccttattcttcatcaaagaattcacagtggggagaaaccttatggatgtgttgagtgtgggaaagcattcagccgaagttccattcttgtgcaacaccagagagtccacactggagaaaaaccttacaaatgtcttgaatgtgggaaagcctttagccagaattcggggcttattaatcatcagagaatccatactggggagaaaccttatgaatgcgttcagtgtgggaaatcgtatagtcaaagctcaaatctttttagacatcagagaagacacaatgcagaaaaacttctgaatgttgtgaaagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Meckel syndrome, type 1
- WNT inhibitory factor 1
- ring finger protein 13
- RAN binding protein 3