MEA1-male-enhanced antigen 1 Gene View larger

MEA1-male-enhanced antigen 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MEA1-male-enhanced antigen 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MEA1-male-enhanced antigen 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001754
Product type: DNA & cDNA
Ncbi symbol: MEA1
Origin species: Human
Product name: MEA1-male-enhanced antigen 1 Gene
Size: 2ug
Accessions: BC001754
Gene id: 4201
Gene description: male-enhanced antigen 1
Synonyms: HYS; MEA; male-enhanced antigen 1; Male-enhanced antigen (H-Y structural gene)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcctgaaaggcatctgtcaggcgcccctgcccggatggcaacagtagttctaggaggagacaccatgggccctgagcgtatcttccccaatcagactgaggaactgggacatcagggcccttcagaaggcactggggattggagcagtgaggagcctgaggaagagcaggaggaaacggggtcgggcccagctggctactcctaccagcccctgaaccaagatcctgaacaagaggaggtggaactggcaccagtgggggatggagatgtagttgctgacatccaggatcgaatccaggccctggggcttcatttgccagacccaccattagagagtgaagatgaagatgaggagggagctacagcgttgaacaaccacagctctattcccatggacccagaacatgtagagctggtgaaaaggacaatggctggagtaagcctgcctgcgccaggggttcctgcctgggctcgggagatatcggatgcccagtgggaagatgtggtacagaaagccctccaagcccggcaggcatcccctgcctggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dihydrofolate reductase
- heme binding protein 2
- homeobox containing 1
- Z-DNA binding protein 1

Buy MEA1-male-enhanced antigen 1 Gene now

Add to cart