DHFR-dihydrofolate reductase Gene View larger

DHFR-dihydrofolate reductase Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DHFR-dihydrofolate reductase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DHFR-dihydrofolate reductase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000192
Product type: DNA & cDNA
Ncbi symbol: DHFR
Origin species: Human
Product name: DHFR-dihydrofolate reductase Gene
Size: 2ug
Accessions: BC000192
Gene id: 1719
Gene description: dihydrofolate reductase
Synonyms: DHFRP1; DYR
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttggttcgctaaactgcatcgtcgctgtgtcccagaacatgggcatcggcaagaacggggacctgccctggccaccgctcaggaatgaattcagatatttccagagaatgaccacaacctcttcagtagaaggtaaacagaatctggtgattatgggtaagaagacctggttctccattcctgagaagaatcgacctttaaagggtagaattaatttagttctcagcagagaactcaaggaacctccacaaggagctcattttctttccagaagtctagatgatgccttaaaacttactgaacaaccagaattagcaaataaagtagacatggtctggatagttggtggcagttctgtttataaggaagccatgaatcacccaggccatcttaaactatttgtgacaaggatcatgcaagactttgaaagtgacacgttttttccagaaattgatttggagaaatataaacttctgccagaatacccaggtgttctctctgatgtccaggaggagaaaggcattaagtacaaatttgaagtatatgagaagaatgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heme binding protein 2
- homeobox containing 1
- Z-DNA binding protein 1
- zinc finger protein 24

Buy DHFR-dihydrofolate reductase Gene now

Add to cart