Login to display prices
Login to display prices
BAALC-brain and acute leukemia, cytoplasmic Gene View larger

BAALC-brain and acute leukemia, cytoplasmic Gene

PTXBC011517

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAALC-brain and acute leukemia, cytoplasmic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAALC-brain and acute leukemia, cytoplasmic Gene

Proteogenix catalog: PTXBC011517
Ncbi symbol: BAALC
Product name: BAALC-brain and acute leukemia, cytoplasmic Gene
Size: 2ug
Accessions: BC011517
Gene id: 79870
Gene description: brain and acute leukemia, cytoplasmic
Synonyms: brain and acute leukemia cytoplasmic protein; brain and acute leukemia, cytoplasmic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcggtgggagccgggcggatgccatcgagccccgctactacgagagctggacccgggagacagaatccacctggctcacctacaccgactcggacgcgccgcccagcgccgccgccccggacagcggccccgaagcgggcggcctgcactcgggcatgctggaagatggactgccctccaatggtgtgccccgatctacagccccaggtggaatacccaacccagagaagaagacgaactgtgagacccagtgcccaaatccccagagcctcagctcaggccctctgacccagaaacagaatggccttcagaccacagaggctaaaagagatgctaagagaatgcctgcaaaagaagtcaccattaatgtaacagatagcatccaacagatggacagaagtcgaagaatcacaaagaactgtgtcaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: