BAALC-brain and acute leukemia, cytoplasmic Gene View larger

BAALC-brain and acute leukemia, cytoplasmic Gene

PTXBC011517

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAALC-brain and acute leukemia, cytoplasmic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BAALC-brain and acute leukemia, cytoplasmic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011517
Product type: DNA & cDNA
Ncbi symbol: BAALC
Origin species: Human
Product name: BAALC-brain and acute leukemia, cytoplasmic Gene
Size: 2ug
Accessions: BC011517
Gene id: 79870
Gene description: brain and acute leukemia, cytoplasmic
Synonyms: brain and acute leukemia cytoplasmic protein; brain and acute leukemia, cytoplasmic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcggtgggagccgggcggatgccatcgagccccgctactacgagagctggacccgggagacagaatccacctggctcacctacaccgactcggacgcgccgcccagcgccgccgccccggacagcggccccgaagcgggcggcctgcactcgggcatgctggaagatggactgccctccaatggtgtgccccgatctacagccccaggtggaatacccaacccagagaagaagacgaactgtgagacccagtgcccaaatccccagagcctcagctcaggccctctgacccagaaacagaatggccttcagaccacagaggctaaaagagatgctaagagaatgcctgcaaaagaagtcaccattaatgtaacagatagcatccaacagatggacagaagtcgaagaatcacaaagaactgtgtcaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NHP2 ribonucleoprotein homolog (yeast)
- malignant T cell amplified sequence 1
- GINS complex subunit 2 (Psf2 homolog)
- prolyl 4-hydroxylase, beta polypeptide

Buy BAALC-brain and acute leukemia, cytoplasmic Gene now

Add to cart