Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000009 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NHP2 |
| Origin species: | Human |
| Product name: | NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000009 |
| Gene id: | 55651 |
| Gene description: | NHP2 ribonucleoprotein homolog (yeast) |
| Synonyms: | NHP2 ribonucleoprotein; snoRNP protein NHP2; NHP2-like protein; NHP2 ribonucleoprotein homolog; DKCB2; NHP2P; NOLA2; H/ACA ribonucleoprotein complex subunit 2; nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccaaaataaaggcagatcccgacgggcccgaggctcaggcggaggcgtgttccggggagcgcacctaccaggagctgctggtcaaccagaaccccatcgcgcagcccctggcttctcgccgcctcacgcggaagctctacaaatgcatcaagaaagcggtgaagcagaagcagattcggcgcggggtgaaagaggttcagaaatttgtcaacaaaggagaaaaagggatcatggttttggcaggagacacactgcccattgaggtatactgccatctcccagtcatgtgtgaggaccgaaatttgccctatgtctatatcccctctaagacggacctgggtgcagccgcaggctccaagcgccccacctgtgtgataatggtcaagccccatgaggagtaccaggaggcttacgatgagtgcctggaggaggtgcagtccctgcccctacccctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - malignant T cell amplified sequence 1 - GINS complex subunit 2 (Psf2 homolog) - prolyl 4-hydroxylase, beta polypeptide - GINS complex subunit 2 (Psf2 homolog) |