NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene View larger

NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000009
Product type: DNA & cDNA
Ncbi symbol: NHP2
Origin species: Human
Product name: NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene
Size: 2ug
Accessions: BC000009
Gene id: 55651
Gene description: NHP2 ribonucleoprotein homolog (yeast)
Synonyms: NHP2 ribonucleoprotein; snoRNP protein NHP2; NHP2-like protein; NHP2 ribonucleoprotein homolog; DKCB2; NHP2P; NOLA2; H/ACA ribonucleoprotein complex subunit 2; nucleolar protein family A, member 2 (H/ACA small nucleolar RNPs)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaaaataaaggcagatcccgacgggcccgaggctcaggcggaggcgtgttccggggagcgcacctaccaggagctgctggtcaaccagaaccccatcgcgcagcccctggcttctcgccgcctcacgcggaagctctacaaatgcatcaagaaagcggtgaagcagaagcagattcggcgcggggtgaaagaggttcagaaatttgtcaacaaaggagaaaaagggatcatggttttggcaggagacacactgcccattgaggtatactgccatctcccagtcatgtgtgaggaccgaaatttgccctatgtctatatcccctctaagacggacctgggtgcagccgcaggctccaagcgccccacctgtgtgataatggtcaagccccatgaggagtaccaggaggcttacgatgagtgcctggaggaggtgcagtccctgcccctacccctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - malignant T cell amplified sequence 1
- GINS complex subunit 2 (Psf2 homolog)
- prolyl 4-hydroxylase, beta polypeptide
- GINS complex subunit 2 (Psf2 homolog)

Buy NHP2-NHP2 ribonucleoprotein homolog (yeast) Gene now

Add to cart