Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of P4HB-prolyl 4-hydroxylase, beta polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about P4HB-prolyl 4-hydroxylase, beta polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014504 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | P4HB |
| Origin species: | Human |
| Product name: | P4HB-prolyl 4-hydroxylase, beta polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC014504 |
| Gene id: | 5034 |
| Gene description: | prolyl 4-hydroxylase, beta polypeptide |
| Synonyms: | CLCRP1; DSI; ERBA2L; GIT; P4Hbeta; PDI; PDIA1; PHDB; PO4DB; PO4HB; PROHB; protein disulfide-isomerase; cellular thyroid hormone-binding protein; collagen prolyl 4-hydroxylase beta; glutathione-insulin transhydrogenase; p55; procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide; prolyl 4-hydroxylase, beta polypeptide; protein disulfide isomerase family A, member 1; protein disulfide isomerase-associated 1; protein disulfide isomerase/oxidoreductase; protocollagen hydroxylase; testicular secretory protein Li 32; thyroid hormone-binding protein p55; prolyl 4-hydroxylase subunit beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccaagtacaagcccgaatcggaggagctgacggcagagtggatcacagagttctgccaccgcttcctggagggcaaaatcaagccccacctgatgagccaggagctgccggaggactgggacaagcagcctgtcaaggtgcttgttgggaagaactttgaagacgtggcttttgatgagaaaaaaaacgtctttgtggagttctatgccccatggtgtggtcactgcaaacagttggctcccatttgggataaactgggagagacgtacaaggaccatgagaacatcgtcatcgccaagatggactcgactgccaacgaggtggaggccgtcaaagtgcacagcttccccacactcaagttctttcctgccagtgccgacaggacggtcatcgattacaacggggaacgcacgctggatggttttaagaaattcctggagagcggtggccaggatggggcaggggatgatgacgatctcgaggacctggaagaagcagaggagccagacatggaggaagacgatgatcagaaagctgtgaaagatgaactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GINS complex subunit 2 (Psf2 homolog) - cyclin N-terminal domain containing 1 - CD300 molecule-like family member g - butyrophilin, subfamily 2, member A1 |