P4HB-prolyl 4-hydroxylase, beta polypeptide Gene View larger

P4HB-prolyl 4-hydroxylase, beta polypeptide Gene

PTXBC014504

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of P4HB-prolyl 4-hydroxylase, beta polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about P4HB-prolyl 4-hydroxylase, beta polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014504
Product type: DNA & cDNA
Ncbi symbol: P4HB
Origin species: Human
Product name: P4HB-prolyl 4-hydroxylase, beta polypeptide Gene
Size: 2ug
Accessions: BC014504
Gene id: 5034
Gene description: prolyl 4-hydroxylase, beta polypeptide
Synonyms: CLCRP1; DSI; ERBA2L; GIT; P4Hbeta; PDI; PDIA1; PHDB; PO4DB; PO4HB; PROHB; protein disulfide-isomerase; cellular thyroid hormone-binding protein; collagen prolyl 4-hydroxylase beta; glutathione-insulin transhydrogenase; p55; procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide; prolyl 4-hydroxylase, beta polypeptide; protein disulfide isomerase family A, member 1; protein disulfide isomerase-associated 1; protein disulfide isomerase/oxidoreductase; protocollagen hydroxylase; testicular secretory protein Li 32; thyroid hormone-binding protein p55; prolyl 4-hydroxylase subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaagtacaagcccgaatcggaggagctgacggcagagtggatcacagagttctgccaccgcttcctggagggcaaaatcaagccccacctgatgagccaggagctgccggaggactgggacaagcagcctgtcaaggtgcttgttgggaagaactttgaagacgtggcttttgatgagaaaaaaaacgtctttgtggagttctatgccccatggtgtggtcactgcaaacagttggctcccatttgggataaactgggagagacgtacaaggaccatgagaacatcgtcatcgccaagatggactcgactgccaacgaggtggaggccgtcaaagtgcacagcttccccacactcaagttctttcctgccagtgccgacaggacggtcatcgattacaacggggaacgcacgctggatggttttaagaaattcctggagagcggtggccaggatggggcaggggatgatgacgatctcgaggacctggaagaagcagaggagccagacatggaggaagacgatgatcagaaagctgtgaaagatgaactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GINS complex subunit 2 (Psf2 homolog)
- cyclin N-terminal domain containing 1
- CD300 molecule-like family member g
- butyrophilin, subfamily 2, member A1

Buy P4HB-prolyl 4-hydroxylase, beta polypeptide Gene now

Add to cart