Login to display prices
Login to display prices
BTN2A1-butyrophilin, subfamily 2, member A1 Gene View larger

BTN2A1-butyrophilin, subfamily 2, member A1 Gene

PTXBC016661

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BTN2A1-butyrophilin, subfamily 2, member A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BTN2A1-butyrophilin, subfamily 2, member A1 Gene

Proteogenix catalog: PTXBC016661
Ncbi symbol: BTN2A1
Product name: BTN2A1-butyrophilin, subfamily 2, member A1 Gene
Size: 2ug
Accessions: BC016661
Gene id: 11120
Gene description: butyrophilin, subfamily 2, member A1
Synonyms: BK14H9.1; BT2.1; BTF1; BTN2.1; DJ3E1.1; butyrophilin subfamily 2 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatcagctgctgccctgcacttctcccggccagcctccctcctcctcctcctcctcagcctgtgtgcactggtctcagcccagtttattgtcgtggggcccactgatcccatcttggccacggttggagaaaacactacgttacgctgccatctgtcacccgagaaaaatgctgaggacatggaggtgcggtggttccggtctcagttctcccccgcagtgtttgtgtataaaggtggcagagagagaacagaggagcagatggaggagtaccgaggaagaaccacctttgtgagcaaagacatcagcaggggcagcgtggccctggtcatacacaacatcacagcccaggaaaacggcacctaccgctgttacttccaagaaggcaggtcctacgatgaggccatcctgcacctcgtagtggcaggactaggctctaagcccctcatttcaatgaggggccatgaagacgggggcatccggctggagtgcatatctagagggtggtacccaaagcccctcacagtgtggagggacccctacggtggggttgcgcctgccctgaaagaggtctccatgcctgatgcagacggcctcttcatggtcaccacggctgtgatcatcagagacaagtctgtgaggaacatgtcctgctctatcaacaacaccctgctcggccagaagaaagaaagtgtcatttttattccagaatcctttatgcccagtgtgtctccctgtgcagtggccctgcctatcattgtggttattctgatgatacccattgccgtatgcatctattggatcaacaaactccaaaaggaaaaaaagattctgtcaggggaaaaggagtttgaacgggaaacaagagaaattgctctaaaggaactggagaaagaacgtgtgcaaaaagaggaagaacttcaagtaaaagagaaacttcaagaagaattgcgatggagaagaacattcttacatgctgagctccaattcttctcaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: