PCOLCE-procollagen C-endopeptidase enhancer Gene View larger

PCOLCE-procollagen C-endopeptidase enhancer Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCOLCE-procollagen C-endopeptidase enhancer Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCOLCE-procollagen C-endopeptidase enhancer Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000574
Product type: DNA & cDNA
Ncbi symbol: PCOLCE
Origin species: Human
Product name: PCOLCE-procollagen C-endopeptidase enhancer Gene
Size: 2ug
Accessions: BC000574
Gene id: 5118
Gene description: procollagen C-endopeptidase enhancer
Synonyms: PCPE; PCPE-1; PCPE1; procollagen C-endopeptidase enhancer 1; procollagen C-proteinase enhancer 1; procollagen COOH-terminal proteinase enhancer 1; procollagen, type 1, COOH-terminal proteinase enhancer; type 1 procollagen C-proteinase enhancer protein; type I procollagen COOH-terminal proteinase enhancer; procollagen C-endopeptidase enhancer
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcctgcagccacagcctccctcctggggcccctcctcactgcctgcgccctgctgccttttgcccagggccagacccccaactacaccagacccgtgttcctgtgcggaggggatgtgaagggggaatcaggttacgtggcaagtgaggggttccccaacctctacccccctaataaggagtgcatctggaccataacggtccccgagggccagactgtgtccctctcattccgagtcttcgacctggagctgcaccccgcctgccgctacgatgctctggaggtcttcgctgggtctgggacttccggccagcggctcggacgcttttgtgggaccttccggcctgcgcccctagtcgcccccggcaaccaggtgaccctgaggatgacgacggatgagggcacaggaggacgaggcttcctgctctggtacagcgggcgggccacctcgggcactgagcaccaattttgcggggggcggctggagaaggcccagggaaccctgaccacgcccaactggcccgagtccgattaccccccgggcatcagctgttcctggcacatcatcgcgcccccggaccaggtcatcgcgctgaccttcgagaagtttgacctggagccggacacctactgccgctatgactcggtcagcgtgttcaacggagccgtgagcgacgactcccggaggctggggaagttctgcggcgacgcagtcccgggctccatctcctccgaagggaatgaactcctcgtccagttcgtctcagatctcagtgtcaccgctgatggcttctcagcctcctacaagaccctgccgcggggcactgccaaagaagggcaagggcccggccccaaacggggaactgagcctaaagtcaagctgccccccaagtcccaacctccggagaaaacagaggaatctccttcagcccctgatgcacccacctgcccaaagcagtgccgccggacaggcaccttgcagagcaacttctgtgccagcagccttgtggtgactgcgacagtgaagtccatggttcgggagccaggggagggccttgccgtgactgtcagtcttattggtgcttataaaactggaggactggacctgccttctccacccactggtgcctccctgaagttttacgtgccttgcaagcagtgcccccccatgaagaaaggagtcagttatctgctgatgggccaggtagaagagaacagaggccccgtccttcctccagagagctttgtggttctccaccggcccaaccaggaccagatcctcaccaacctaagcaagaggaagtgcccctctcaacctgtgcgggctgctgcgtcccaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant alpha 1
- growth factor receptor-bound protein 7
- butyrophilin, subfamily 3, member A3
- Rho-related BTB domain containing 1

Buy PCOLCE-procollagen C-endopeptidase enhancer Gene now

Add to cart