Login to display prices
Login to display prices
PCOLCE-procollagen C-endopeptidase enhancer Gene View larger

PCOLCE-procollagen C-endopeptidase enhancer Gene

PTXBC000574

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCOLCE-procollagen C-endopeptidase enhancer Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCOLCE-procollagen C-endopeptidase enhancer Gene

Proteogenix catalog: PTXBC000574
Ncbi symbol: PCOLCE
Product name: PCOLCE-procollagen C-endopeptidase enhancer Gene
Size: 2ug
Accessions: BC000574
Gene id: 5118
Gene description: procollagen C-endopeptidase enhancer
Synonyms: PCPE; PCPE-1; PCPE1; procollagen C-endopeptidase enhancer 1; procollagen C-proteinase enhancer 1; procollagen COOH-terminal proteinase enhancer 1; procollagen, type 1, COOH-terminal proteinase enhancer; type 1 procollagen C-proteinase enhancer protein; type I procollagen COOH-terminal proteinase enhancer; procollagen C-endopeptidase enhancer
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgcctgcagccacagcctccctcctggggcccctcctcactgcctgcgccctgctgccttttgcccagggccagacccccaactacaccagacccgtgttcctgtgcggaggggatgtgaagggggaatcaggttacgtggcaagtgaggggttccccaacctctacccccctaataaggagtgcatctggaccataacggtccccgagggccagactgtgtccctctcattccgagtcttcgacctggagctgcaccccgcctgccgctacgatgctctggaggtcttcgctgggtctgggacttccggccagcggctcggacgcttttgtgggaccttccggcctgcgcccctagtcgcccccggcaaccaggtgaccctgaggatgacgacggatgagggcacaggaggacgaggcttcctgctctggtacagcgggcgggccacctcgggcactgagcaccaattttgcggggggcggctggagaaggcccagggaaccctgaccacgcccaactggcccgagtccgattaccccccgggcatcagctgttcctggcacatcatcgcgcccccggaccaggtcatcgcgctgaccttcgagaagtttgacctggagccggacacctactgccgctatgactcggtcagcgtgttcaacggagccgtgagcgacgactcccggaggctggggaagttctgcggcgacgcagtcccgggctccatctcctccgaagggaatgaactcctcgtccagttcgtctcagatctcagtgtcaccgctgatggcttctcagcctcctacaagaccctgccgcggggcactgccaaagaagggcaagggcccggccccaaacggggaactgagcctaaagtcaagctgccccccaagtcccaacctccggagaaaacagaggaatctccttcagcccctgatgcacccacctgcccaaagcagtgccgccggacaggcaccttgcagagcaacttctgtgccagcagccttgtggtgactgcgacagtgaagtccatggttcgggagccaggggagggccttgccgtgactgtcagtcttattggtgcttataaaactggaggactggacctgccttctccacccactggtgcctccctgaagttttacgtgccttgcaagcagtgcccccccatgaagaaaggagtcagttatctgctgatgggccaggtagaagagaacagaggccccgtccttcctccagagagctttgtggttctccaccggcccaaccaggaccagatcctcaccaacctaagcaagaggaagtgcccctctcaacctgtgcgggctgctgcgtcccaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: