Login to display prices
Login to display prices
TYR-tyrosinase (oculocutaneous albinism IA) Gene View larger

TYR-tyrosinase (oculocutaneous albinism IA) Gene

PTXBC027179

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TYR-tyrosinase (oculocutaneous albinism IA) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TYR-tyrosinase (oculocutaneous albinism IA) Gene

Proteogenix catalog: PTXBC027179
Ncbi symbol: TYR
Product name: TYR-tyrosinase (oculocutaneous albinism IA) Gene
Size: 2ug
Accessions: BC027179
Gene id: 7299
Gene description: tyrosinase (oculocutaneous albinism IA)
Synonyms: ATN; CMM8; OCA1; OCA1A; OCAIA; SHEP3; LB24-AB; SK29-AB; monophenol monooxygenase; oculocutaneous albinism IA; tumor rejection antigen AB
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcctggctgttttgtactgcctgctgtggagtttccagacctccgctggccatttccctagagcctgtgtctcctctaagaacctgatggagaaggaatgctgtccaccgtggagcggggacaggagtccctgtggccagctttcaggcagaggttcctgtcagaatatccttctgtccaatgcaccacttgggcctcaatttcccttcacaggggtggatgaccgggagtcgtggccttccgtcttttataataggacctgccagtgctctggcaacttcatgggattcaactgtggaaactgcaagtttggcttttggggaccaaactgcacagagagacgactcttggtgagaagaaacatcttcgatttgagtgccccagagaaggacaaattttttgcctacctcactttagcaaagcataccatcagctcagactatgtcatccccatagggacctatggccaaatgaaaaatggatcaacacccatgtttaacgacatcaatatttatgacctctttgtctggatgcattattatgtgtcaatggatgcactgcttgggggatctgaaatctggagagacattgattttgcccatgaagcaccagcttttctgccttggcatagactcttcttgttgcggtgggaacaagaaatccagaagctgacaggagatgaaaacttcactattccatattgggactggcgggatgcagaaaagtgtgacatttgcacagatgagtacatgggaggtcagcaccccacaaatcctaacttactcagcccagcatcattcttctcctcttggcagattgtctgtagccgattggaggagtacaacagccatcagtctttatgcaatggaacgcccgagggacctttacggcgtaatcctggaaaccatgacaaatccagaaccccaaggctcccctcttcagctgatgtagaattttgcctgagtttgacccaatatgaatctggttccatggataaagctgccaatttcagctttagaaatacactggaagagatgggatttctccatgttggctgggctggtctcaaactcctgacctcaagagatccaccaccttggcctcccaaaatgctgggattacaggcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: