Cart 5 Product Products 511,53 € (empty)
-
-
1 x ZNF193-zin...121,50 € -
1 x C6orf134-c...121,50 € -
1 x MRGPRX3-MA...121,50 € -
No products
To be determined Shipping
511,53 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 511,53 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 511,53 €
View larger 
Data sheet of TYR-tyrosinase (oculocutaneous albinism IA) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TYR-tyrosinase (oculocutaneous albinism IA) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027179 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TYR |
| Origin species: | Human |
| Product name: | TYR-tyrosinase (oculocutaneous albinism IA) Gene |
| Size: | 2ug |
| Accessions: | BC027179 |
| Gene id: | 7299 |
| Gene description: | tyrosinase (oculocutaneous albinism IA) |
| Synonyms: | ATN; CMM8; OCA1; OCA1A; OCAIA; SHEP3; LB24-AB; SK29-AB; monophenol monooxygenase; oculocutaneous albinism IA; tumor rejection antigen AB |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcctggctgttttgtactgcctgctgtggagtttccagacctccgctggccatttccctagagcctgtgtctcctctaagaacctgatggagaaggaatgctgtccaccgtggagcggggacaggagtccctgtggccagctttcaggcagaggttcctgtcagaatatccttctgtccaatgcaccacttgggcctcaatttcccttcacaggggtggatgaccgggagtcgtggccttccgtcttttataataggacctgccagtgctctggcaacttcatgggattcaactgtggaaactgcaagtttggcttttggggaccaaactgcacagagagacgactcttggtgagaagaaacatcttcgatttgagtgccccagagaaggacaaattttttgcctacctcactttagcaaagcataccatcagctcagactatgtcatccccatagggacctatggccaaatgaaaaatggatcaacacccatgtttaacgacatcaatatttatgacctctttgtctggatgcattattatgtgtcaatggatgcactgcttgggggatctgaaatctggagagacattgattttgcccatgaagcaccagcttttctgccttggcatagactcttcttgttgcggtgggaacaagaaatccagaagctgacaggagatgaaaacttcactattccatattgggactggcgggatgcagaaaagtgtgacatttgcacagatgagtacatgggaggtcagcaccccacaaatcctaacttactcagcccagcatcattcttctcctcttggcagattgtctgtagccgattggaggagtacaacagccatcagtctttatgcaatggaacgcccgagggacctttacggcgtaatcctggaaaccatgacaaatccagaaccccaaggctcccctcttcagctgatgtagaattttgcctgagtttgacccaatatgaatctggttccatggataaagctgccaatttcagctttagaaatacactggaagagatgggatttctccatgttggctgggctggtctcaaactcctgacctcaagagatccaccaccttggcctcccaaaatgctgggattacaggcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splicing factor 3b, subunit 3, 130kDa - betaine-homocysteine methyltransferase - procollagen C-endopeptidase enhancer - immunoglobulin heavy constant alpha 1 |