Login to display prices
Login to display prices
CD300LG-CD300 molecule-like family member g Gene View larger

CD300LG-CD300 molecule-like family member g Gene

PTXBC025395

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CD300LG-CD300 molecule-like family member g Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CD300LG-CD300 molecule-like family member g Gene

Proteogenix catalog: PTXBC025395
Ncbi symbol: CD300LG
Product name: CD300LG-CD300 molecule-like family member g Gene
Size: 2ug
Accessions: BC025395
Gene id: 146894
Gene description: CD300 molecule-like family member g
Synonyms: CLM-9; CLM9; NEPMUCIN; TREM-4; TREM4; CMRF35-like molecule 9; CD300 antigen-like family member G; triggering receptor expressed on myeloid cells 4; CD300 molecule like family member g
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggcttctggtcctgctatggggttgcctgctgctcccaggttatgaagccctggagggcccagaggaaatcagcgggttcgaaggggacactgtgtccctgcagtgcacctacagggaagagctgagggaccaccggaagtactggtgcaggaagggtgggatcctcttctctcgctgctctggcaccatctatgcagaagaagaaggccaggagacaatgaagggcagggtgtccatccgtgacagccgccaggagctctcgctcattgtgaccctgtggaacctcaccctgcaagacgctggggagtactggtgtggggtcgaaaaacggggccccgatgagtctttactgatctctctgttcgtctttccaggaccctgctgtcctccctccccttctcccaccttccagcctctggctacaacacgcctgcagcccaaggcaaaagctcagcaaacccagcccccaggattgacttctcctgggctctacccggcagccaccacagccaagcaggggaagacaggggctgaggcccctccattgccagggacttcccagtacgggcacgaaaggacttctcagtacacaggaacctctcctcacccagcgacctctcctcctgcagggagctcccgcccccccatgcagctgaactccacctcagcagaggacaccagtccagctctcagcagtggcagctctaagcccagggtgtccatcccgatggtccgcatactggccccagtcctggtgctgctgagccttctgtcagccgcaggcctgatcgccttctgcagccacctgctcctgtggagaaaggaagctcaacaggccacggagacacagaggaacgagaagttctgcctctcacgcttgactgcggaggaaaaggaagccccttcccaggcccctgagggggacgtgatctcgatgcctcccctccacacatctgaggaggagctgggcttctcgaagtttgtctcagcgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: