MCTS1-malignant T cell amplified sequence 1 Gene View larger

MCTS1-malignant T cell amplified sequence 1 Gene

PTXBC001013

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MCTS1-malignant T cell amplified sequence 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MCTS1-malignant T cell amplified sequence 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001013
Product type: DNA & cDNA
Ncbi symbol: MCTS1
Origin species: Human
Product name: MCTS1-malignant T cell amplified sequence 1 Gene
Size: 2ug
Accessions: BC001013
Gene id: 28985
Gene description: malignant T cell amplified sequence 1
Synonyms: MCTS1, re-initiation and release factor; MCT-1; MCT1; malignant T-cell-amplified sequence 1; malignant T-cell amplified sequence 1; multiple copies T-cell malignancies; multiple copies in T-cell lymphoma-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcaagaaatttgatgaaaaagaaaatgtgtccaactgcatccagttgaaaacttcagttattaagggtattaagaatcaattgatagagcaatttccaggtattgaaccatggcttaatcaaatcatgcctaagaaagatcctgtcaaaatagtccgatgccatgaacatatagaaatccttacagtaaatggagaattactcttttttagacaaagagaagggcctttttatccaaccctaagattacttcacaaatatccttttatcctgccacaccagcaggttgataaaggagccatcaaatttgtactcagtggagcaaatatcatgtgtccaggcttaacttctcctggagctaagctttaccctgctgcagtagataccattgttgctatcatggcagaaggaaaacagcatgctctatgtgttggagtcatgaagatgtctgcagaagacattgagaaagtcaacaaaggaattggcattgaaaatatccattatttaaatgatgggctgtggcatatgaagacatataaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GINS complex subunit 2 (Psf2 homolog)
- prolyl 4-hydroxylase, beta polypeptide
- GINS complex subunit 2 (Psf2 homolog)
- cyclin N-terminal domain containing 1

Buy MCTS1-malignant T cell amplified sequence 1 Gene now

Add to cart