Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MCTS1-malignant T cell amplified sequence 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MCTS1-malignant T cell amplified sequence 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001013 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MCTS1 |
| Origin species: | Human |
| Product name: | MCTS1-malignant T cell amplified sequence 1 Gene |
| Size: | 2ug |
| Accessions: | BC001013 |
| Gene id: | 28985 |
| Gene description: | malignant T cell amplified sequence 1 |
| Synonyms: | MCTS1, re-initiation and release factor; MCT-1; MCT1; malignant T-cell-amplified sequence 1; malignant T-cell amplified sequence 1; multiple copies T-cell malignancies; multiple copies in T-cell lymphoma-1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcaagaaatttgatgaaaaagaaaatgtgtccaactgcatccagttgaaaacttcagttattaagggtattaagaatcaattgatagagcaatttccaggtattgaaccatggcttaatcaaatcatgcctaagaaagatcctgtcaaaatagtccgatgccatgaacatatagaaatccttacagtaaatggagaattactcttttttagacaaagagaagggcctttttatccaaccctaagattacttcacaaatatccttttatcctgccacaccagcaggttgataaaggagccatcaaatttgtactcagtggagcaaatatcatgtgtccaggcttaacttctcctggagctaagctttaccctgctgcagtagataccattgttgctatcatggcagaaggaaaacagcatgctctatgtgttggagtcatgaagatgtctgcagaagacattgagaaagtcaacaaaggaattggcattgaaaatatccattatttaaatgatgggctgtggcatatgaagacatataaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GINS complex subunit 2 (Psf2 homolog) - prolyl 4-hydroxylase, beta polypeptide - GINS complex subunit 2 (Psf2 homolog) - cyclin N-terminal domain containing 1 |