GINS2-GINS complex subunit 2 (Psf2 homolog) Gene View larger

GINS2-GINS complex subunit 2 (Psf2 homolog) Gene

PTXBC010164

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GINS2-GINS complex subunit 2 (Psf2 homolog) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GINS2-GINS complex subunit 2 (Psf2 homolog) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010164
Product type: DNA & cDNA
Ncbi symbol: GINS2
Origin species: Human
Product name: GINS2-GINS complex subunit 2 (Psf2 homolog) Gene
Size: 2ug
Accessions: BC010164
Gene id: 51659
Gene description: GINS complex subunit 2 (Psf2 homolog)
Synonyms: HSPC037; PSF2; Pfs2; DNA replication complex GINS protein PSF2; GINS complex subunit 2 (Psf2 homolog); GINS complex subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgctgccgaggtcgaattcctcgccgagaaggagctggttaccattatccccaacttcagtctggacaagatctacctcatcgggggggacctggggccttttaaccctggtttacccgtggaagtgcccctgtggctggcgattaacctgaaacaaagacagaaatgtcgcctgctccctccagagtggatggatgtagaaaagttggagaagatgagggatcatgaacgaaaggaagaaacttttaccccaatgcccagcccttactacatggaacttacgaagctcctgttaaatcatgcttcagacaacatcccgaaggcagacgaaatccggaccctggtcaaggatatgtgggacactcgtatagccaaactccgagtgtctgctgacagctttgtgagacagcaggaggcacatgccaagctggataacttgaccttgatggagatcaacaccagcgggactttcctcacacaagcgctcaaccacatgtacaaactccgcacgaacctccagcctctggagagtactcagtctcaggacttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prolyl 4-hydroxylase, beta polypeptide
- GINS complex subunit 2 (Psf2 homolog)
- cyclin N-terminal domain containing 1
- CD300 molecule-like family member g

Buy GINS2-GINS complex subunit 2 (Psf2 homolog) Gene now

Add to cart